Description :
From Genome Similarity Track
Location :
Scaffold_31:169772- 170791
Sequence
1019 bases(100 bases per row)
TCAAGAAGATCAGCTACAACCATGCTTCGAAGTCGATTCATCTGTTCTTTGTCCACCGTGCCACGGCAACAAAAATTCAATACACGACGGCTCGGTTCAC
GCGAGTGGAGTACCACTTGAATACCAAGCATTTCCCTTCTTCGGGCTCAGCCTGGGAGAGACAGCAAGGATCAGTGAATTTCTAGACTCTTCGAAAACTG
GAGTACGAGATATACCTATACAATATTTCGAGGTTCGTCGATATTGGGAAGATATCAGCGTTTATCAGTAAGCACAGTCCTGTGAAGCATGATCTCGAAG
ACATGGGTTGTTGTACACCACTGTCTGGAAGTGAACTTACTTGCTTGCTGGGTGTTCGCAATCTCTACAGAGGATTGTACGCTGGAATTGGTTTGGAACC
ACCATCATTTTAAAGCATCCAGTGGTTGGTCTCCCGCTACAGCGCTACAAATGTGGTAAAATCGGCCACATGTCGGCATGATGTGGCTACACAGATGATC
AACTGAAAGGCAGTGGATGTTTTAATAGCCACTGAACAGGAGTTTGTGGCACTTGATGATGCCGCCAAGACTTTTGCTAACATGGAGGATATGGATGTTG
CAGCCTCTTCAACATGACACAGCGTCTGTCCGGAACCGTACGATTCAACCCCATCCCACGTCGGAGAACAGAATCCAATCGGCTCTGTCCGGCGAGATGA
TCAATTCCAATCACCCAAGTACAACGGTATTTACGCAATACGACCGACCCACACAAGAACGATCTCACGACTCTACCCACCCGAAAGAGAACTTAATGGA
TTAAGGTACCGTTGCGTGGTAAACGTCGTCTATTTGCAGCCAAGATTTCGCTAGCACAGCAGCCCGAAGGACGACCTACACAATATGACGTTCGATCAGG
AGACGATAGTTTTGCCTTGGATGGTAACGAACCCACACCACCAGACAATAAGGATCATGTGGTGGAACCTATAGACATATCGCCGACAGAGGAGACCGCA
GACCAGACAGCCCATAACG