Description :
From Genome Similarity Track
Location :
Scaffold_68:16977- 20397
Transcript NameFunction/comments
Physo_138910reverse transcriptase

Sequence
3420 bases(100 bases per row)
GGTCAGCTCGATCTCGAATTGCCTCACGTAGGCACTCATTGACTTGCTTCCGGGCCTGCTGATATTGCTTCTGGACATGATAGCGCCACCTGCGAGGCTG
TCGATCCCGCCGGCGCGTCGATCCCAGCGGTACCATTGCCTCCAGAGTAGATCGAGGGTCCCACTCATGTACTCTCCCCGAATTCGATCTTGGGCCGTGT
TGAGCGCAAAAGTAAGGCGCTCCGCGTACTCTTCCCAATCTCGCTGGTTGATGTCTTCGACATACATCTTCAGAGCGCGAGTGAGCGTCTGCACCATCCG
CGCAGCGGTACCATTGGCCTGAGGCCGATAAGCCATAGTCGCACGTTGCCTCTGACCGACGATCTTGTTGAATGATCTGAAGAAATCCGACATAACTCCT
GGCTCGCGGTCATGTCGTATCGCTTCGCTAGCGCCAAATCGGCGACACACGCACTCCTCGTAGTTCTTAGTGATCGTTTGGGCTGTTCTAGACGAGCTGA
CCTTTGCAATCACGAATCCCGTGAAAAGATCGATCCAGATCAACAACTCGGTGTTCCCTTTGTACGACTTGGGTAATGACGGGATGTGGTCCATGGCAAT
AATCTGGAACGGGTAGGTAGCCTGAAGATTACCGGGAGATTCTCCTTGTGTAGTCGGCCTCCCTTTCCCGGTTTCGCAGTCCACGCACAGCCCCACGTAT
CGTTGTACACTTTGGTAGAGGCCTCTCCAGTGAAAATGGGCACGAATCCGCTGGTAGGTTCTTCCAATGCCTTGGTGGCCACCCTCGAGACTGGCATGAT
AATGGTGTAGGAAGTCCTGCTGCAAGGTCTCCGGGATCACCAGCCGCATCACAAGATGACGACCTTCATCAGAGCGCTTCGATGGCGGGCAGTAGAACAG
CAATCCAGCTTCGTCGACCTCGTAGTCATCGGCAATCTTGGCACACGCTTTAGCCTCCGCCGAGGTAAGGTCCTGCACGTCCCCAAGTAGATACTTCTTG
AGATCGGCAATCCGCTTCTCTTCATCCTGGGCCTGGCAAATGCGCTCCGTCCGCATTCGTTGTACCATCAACTCATCCAACACTTGTGAGGCCGCTCGTC
GTAACCGCCGCGATCTTGATCACTGCCGCGTCAGATCGAGGAACCAATCGTTCGTCGAGGCGGTTGAGCGTCCCCAGATCTTCGCGTTCTTCGTTTGTTG
TAACGATGGAGTCACCTTCCCGTTGTAGTGCTGCGCTTGCAAGTCGATCTGCACTCTGGTTCCAGTCACGTTTCATGTGGAGAAATTCGTGGTTAGGCCA
AGATCGCAACTGTTCCATGGCCTTCTGACGTGGTAGTACCAAACTCGGGCCTTGCACTCGATCTCTCCACGCATCTGACGGATCACCAAGTTGGAGTCAC
CACAGATGATCAGGCGGCGCCCTCTGTCCAGGTTAGCCAGGAGATCGAAACAAAGCAGCAAGCCGTGATACTCCGCCTCATTCACCGTAAGATCAACCTA
GTACTCCGAGGCGGCCGAGATCACCTTCCATTCCGGCAATCCCTACACAATCGCGCTGTAGGCACCCCCACTTCGTTTCACACGAGCTGATCCGTCGAAG
CTAACCACCAGCAGTTCTTCACCAATCTCTACAGCGGGCGGCGGCATCGTGATCGTTTGTCGCGGTTGTTTCCTGGGGGAGATCGACGTCAGCATGGCGT
CGACTTCTTCGCGTAGCGTTATGCTCGCAGCTATCACACCCAAGATCTCATTTTCTCCCTTCGTGCACTTCACGATCTCCAGTGTCCACGACGACAGTAA
CACTGGCCAACGGCCAAGGCGCCTTTGCAGGCCGGATGAGTGCACCAGCCAAACCAACGTTGAGTATCGGGTCAGGACCTTGATCGATCTGGTAACCAGT
TGCGTGTAGCAGACATCCAATATCAGGAGCTGTGCCAACACCTCCTTATCCACCATTCCATAGTTGATCTCGTTCGGCTTGAGCGTCCGGCTGGTAAAGG
TCACTGGCTTGTACACTCCGTCGTGTTCCTGCATCAACGCCGCGGAAATTGCCCACTTACTGGCGTACACTACGACGACTGGTTCTCGGTCTGGGTCAAA
ATGCTGCAGGATCGGCGCCTTGACGATCTTGTCCTTCAACACTGTAAACGCCGTGATGGCCCGGCCCCACTTGTCCTGGCCCGGTTGATCTTGATCCGGT
TCGACTCTTCCTTGAGCAACACCGATCTTGGACTGCTGTCGGGTGATTTCGTAGAAGTCAGCCTCCCGGAGCTCATACCGCACGGAAGCGTAGACCGCAA
AGTCATCAATGAACCTGCTGTAGTAGTTGAGACTACCCAAGAACGACTGCATCGATCTCAGGGTGGTCGGAAACGGCAGATTAGCAAACGCTGATAGATC
CTTCGGGTGAGCCTCTAGACCTTCCGCAGACACTCGATGTCCCAAATTGTCGACCTTCATCAATCCCCAAAAACTCTTGGCCACGCTGATCGACAAGTTT
CATTCCTCGCAGACATCTAGCAGCTTCTCCACTTTCTCACACAGCGTATCACACGAACCGGCCGTGACCAGGATGTCATCGATATAAGATCGACGCCCCA
GGACAGAGGTCTTTTGCTCGACGTTTGATTCTCCGTCCTTGAAAAGGTCGATCTGTCCCTGTCGATTTTGGTTGTCCGTGATCTTGAGGAAGCCGTAGAG
TGCGTTGTCGATCAACCGCTGATAGATCTGCGGCGCGTTCTTCAATCCGAATGGCCTTCGATTCCACTCGTAGAGTCCCCATGGAGTGATGAACGCGGAG
ATCGCACGAGTTCGATCTGTCATCGTCACCACCCAGAAACCGCTAGCGATATCCAGCGAGCAATACCAGAGCACCTTGTCGAGATCCTCGAGGAGATTGT
CGATCAGCAGCATCGGGTAGACCATTATACGCGTCAGACTGTTGACCAGACGGTAGTCAATACAGAGTCTGATGTCGACTCCGTTCTTTATGACGATCAC
CACGATCGGTGATGCCCAAGGAGACGTTGAAATCTTGATCATCTTGGCTGACAGGAGTCCCTTGATTAGCTGCGCCAGCTTCTCGCGGTACTGCGGCGCC
ACTTTACGGCAACGCTGAGCGACTGGCTTCGCATTTCCAACGTCAATGTCGCAGATCGCAACTTTTGCGGCAGCTGGTAAGGCATTTCCCTTTCCCATGA
GTAGATGCTTCCGACGCCAGATGATCCTCCGCAGTCGGTCCATTTCCTCCGGCGTGTTTTCGCCAAGATCGCCCACTTGGATGTCCGTGATCACAACTTC
ATCGGTCGTAGAGAACTCCGGGAGCACTGCCATTTGACCTTCCACGTCTTCCGCGTAGAGATCGCCACTTTCCGTCATGCATACCTCAGGATCATCTGAT
TCGACCGGTCTTGGGCGCGC