Description :
From Genome Similarity Track
Location :
Scaffold_29:16976- 22487
Transcript NameFunction/comments
Phyca_LT1534528329ATP-binding Cassette (ABC) Superfamily
Phyca_LT1534568435Hypothetical protein

Sequence
5511 bases(100 bases per row)
acgagtcgaccgccatcttcaaagcgaatagcatcatctacaaactccgaattgatgaactctgcacgcgttgtaacaactactcgagtcttgttgcgca
gaagccccagtagacagcgagaaaagatctcccgcgctgcagatctggggtgaactcgtgccagaggcttgtcaagcaggtacacgtcggcgtcactgta
gcaagcacgtgccagactgacgagtgcctgctgccctgaggttggactccagtcttggataagtgtatggtcgcccgccgacagcatcgcaatgggattg
acgagtgcgcaagcatccagcacgcgttggtacttacgtctgtcaaatggaaggccaaatagaatgttatcccgcacagacagcgtttgttggagccaga
actgctgcggacaatacgccacagatccgccaacatacacacgcccaccacctccgtcacttccatcgcgtgcatgcatctcacccagtagagcggaaag
aaaggaagacttgccactaccaggacgaccgtgaaccaccaacagctcccccgcacctacagtcacgtccaagtgctggaaaacgaccggaccgttggtc
gcccagcccaacgtggcatcttcaacagcaacaacgacatcctgcgggtcgtatttggctaccaggcccagactgtcacgtcgagcaacagcgtatgggt
tcaactcttcctggtccataaactgtgagaggttgcgaagtgactgccacgcagcacgagcccctaacgcggcctcaggcagagtccgtagtggcgtctg
aatgagacgcacaagcgccaatgtggcaaaagctgacgctgctgtgagcgggtgcgtagccgaatgatgccggtagcccactgccagagctgctgtagct
atcaacactggagtcgcgtagttgaacgcagcttctgcagcacctcgcacctggaagcgccacaaagctgcgagttctcgtccgcgcgaggcattcacgc
gtgatcttgcagaaggttcccacgcatgcagcttaacggcaggcatagcgtgcaccatctcgttggtcgagctctgtctgtcctccctcgttcgtcgtag
tcgatccagagaccggaactgcagttgattcagcacttgagacgctacgaacgccactactacagctcctacagctgctccacacgctgcaacaccaacg
aacttctcgatcagagccaaacttaaggccagcgtcaacggcgccgcccatagttcgtgcagacacgcagcaccacgcaggagctgcgtcacatcagtag
cgtagagcacatcagcgtctcgagcggaggaattggagagcctcagtgctttctggaagacgaggctctggagtgcagcagtaaggcgcagcgtcgatgt
ctgcagctccgctcgcacaaaggctgacagcagcgcgcgtaacaggcgggaaaagagcagcacgcccagccagaagagcaggctgcgaccggtttcactg
tcctgttggtccagtagcagcacgctgcggaacagcacgtaaggcccgaggaggtcgcagagctgtacgaaggcgtgcagtacgccaatacctgcgaatt
gcaggccgtgcgccttgaggaaggctagcgatagcgacccagtagagatccacgcgcgctgcaacgcgttagcgccaggctcggcacgttcgcgtggcgg
cagctcccagacatccgcctgctgtagcccgcgcctggcagatcctcgaccttgacgctgctgctggacccggtactgcgtctgatactgcagtgggggc
acctgagtctgagtctgtggtcggttggcgagcgtgaccgacggtgtgacccactgcagcaacaaacggctggtcagtgacgcacactcgatcggatgtg
tgaacacctggggcggtggtgcgccggaaagcagcggctggcgctcggcgcgggctgtggacgcggtggacaagatggaggagcgcgcaaaggcgtcgct
gtcggcgccggcgctcgctgtgctgcgtcgcgcgtgcggcagcatccttccttcctttctccagtgcggatgcatatcccttggaaattatatattgacc
ttccattttgaatttacctcgggaattctatccatttgagcagaatcgcatccgcaacgcacggctcaaatcggacagcgcgccgaaccgctcagtagtt
ggttagtcgaagctcaactgaaccctctacggctacttggtcaagttgctgataccttgctcgctactggtatcggatatggcacggttgcagtcaactt
caacgtcgacctcggcggactaaaagcagatgagtcagaggcgggcgcgaggcaagcaaacgctcttccgacctcgagcgccagagctcgtgggcgattt
gagtgcggcgcttgtggacgcgtctgtctcgcgcaggacgacaccagcattgcgctgcgccgtctctacgatcggcccattaggacacaccgcacggccc
aacaatgtggcggcgcggccaacgcctcgacccccgactgcagtgatcagcgacgctcaacataagcttcatactgtcttgcctcctaccattactgtgg
aggggagttactatgctgcatcatgcgccacaggcccaagtcttcgctagcggcgtcaaggctaaagatgcaggtggcacatgcggcaggagcgaggcta
ggatgggttgacagacgttgaccttcattttgtaagaccaaagattgtgtacacttggtgtacaagtcgagtcgtaccctaaagtcagctagaaaaagga
gccaggagccggtccagtgccatgcagcaagcgaccgccatagtaaaagcagcgcggaaccgagtatggcacgcggactgcagagctgttcgctgctgct
actgctagtggtggtgctctcaggcgtctgttgcgccttcaacagcaccgaacaggaatcagacgcaggaactccatccacgacgaccaccacggacgcg
acgaccaactttgccacagatgaagacgaccgcgaaacggtgcgacagaagcaattgacagcgctgagggtctgcggctggctggtgctgctgctgtaca
ttccgctgtccttggccgtggcctggcgcgcctcactgcacttcctgtactcgagtcgcggcgccaagaaggccttccacgtgacgttactagtatcgac
actgctgcagctccctgaagccattgaatggatatggtaccccacgtcgcagagttgggagaccatgtacatctgccgtctctactctctgctgctgctg
tcgttctgcaagtcgtacctggctatctgctgggctggcgtcgtctcggcaggacagcaactcgcacgccgtcgcatgaccaaactcgtggcggtgctca
actcattgctcgtgctttggggactgattgtgcccattctactctccaaatacagtgatgacatctacggccagtacagcttcatgagcagcacccttcg
aggtgtactgacgtattcaggtgtggcggtcgtgctgacgtacggccttctgctgggctaccagggcttccgtctgcgccgccgtctgctgctcgctcgc
ggcacagttcccgccagtagtgtggagaaatcactcaaccagctcatgcttgccatcttcatcttcatcgtgtcggacgtggtgcgtctgctagctctgg
tgctgaacgagacaggcactcccatgtcaatgatcgtgtatctgatcctgtacaacattatccccagcgtcttccctactatctgcatgctgtaccttat
gaggaggctcacgggaagaggtggtagtgacgtcggcgtgagccacatcaagggcctcggcggcaagcccccgcgaacgttatccaagtacatgaccgag
gagcctgactcggacggcagcagcagaagtagcacgggcagtgacagtgctggacgtgcatacgacgagaacgccattgccagagcacaatgggagcttc
atgctcagcaacagtatctccaacaacagattcaaagcgcccgggaagcgcaggaatctcctgcattctgctgggtccgcgagtccatggagctccgctg
aaaccatctaccggtagcaacgctccactctctaggcagatagacaacttcacaatggacgccttaagttattcatcaacaaccacttccatttgttgat
taagttttactgctccgttcctccccaatgcgatagttgaagttcttgtgagcgtagtaaagcagccttctcgcgtagtcgacgcagctgcacgagttga
gaacccaatacgttcaaccgaattccacagcgtagagcaagtcttgggggccatgcttggccaattccgactgcttcgtccgtcgtaatgactcgggtag
ctccaatggcaactcgtacgtcgccataggtggtttcaacgtacgcgaagagggcttggagctcgatgatcgacgctttgggacggaaggtcgaggtgaa
gttatgtcacctgcttcgtccgatgatgaagacgacgacgaatcggaaggcattggcttgtccggtttcatttctgaggcagcagcagggagctccgtaa
ttgtgggttgcgcgacgttgcttgtacgggaaataatatcttcgattgagagctgcgcacgccccaaaacccgttgccttgtcgaggacagcggtcctcc
atcacatagacgcaaggctagtacatcccccagagctgttacaggcaatataaagctctcgtgccacagtggcgagcggcttttcttgctcaccgacgtg
ttttcaacttgagtcgacgaagtggaggtgtgtccacctccttttttcttaccaaaggagtttccggtcgcggtggtcccagattgcacacaaaactgta
cgaaggattgaataggcgatgcaatcggaagtagactcactccttgcacgtccacattgagagttcccacacttggagcaccatcttcactatcacgaag
cttttttatatttttctccagtttttccatgtcctcttccagttttctcccgtgttctcggatttcgtcagccacatcctcctcgcccttgtcaccagtt
atcacgtaacgtgggagcctattaaggaaaactcgccccggaggcaacgacgccttcgcgcttgccgccaggtgtgtgcccaagtgtccaagatatttac
tttccagtgccgcttgcttcgccttcagtaatttaagacgatgctcgtcagtcaagtcttggtggctcttgagggcataggctgcccagccgacaaaagt
gaatagacctcccaacgtcaccactcgctgctcaaaagtcttgttatccaggttggcagtactcgtatccacaaaaatcatcagcaaaaagatggtagag
tgaagaacagcaccgatcctcaacacgtgcaagtaaccaagccatgagcccaaagagagcgcttgaattggaaaaggtcgttgcgtatcgtagcacaaac
tgtgtgcatct