Description :
From Genome Similarity Track
Location :
Scaffold_36:169708- 170719
Transcript NameFunction/comments
g3832.t1hypothetical protein

Sequence
1011 bases(100 bases per row)
TTCTCCAGCCTGGGTTTCCTTTTCCAGGTTGAGTCACTGTTGTCCACACACGGCAAGGAAATCGGCATGTTGGAAGACATGGCGGGCTCGGTGGAACATT
TGAGCTGTGTGGCGTTTGTGATTCAAGATGTTCGTGATAAGCCCATGAACCGTTTCTCGTTCCGCATGTCACGCCGCAAAGATGTGGCTGACGAGGCCGG
CGTTGTGAAGGTCACTGTCTCGAACAAGACGGGTGCGAAGCGATCTCACATCAAGTACATCGTGACAGTGCAAGTCGCCACCAGCGAAGTGGAGCTGCCC
GAGCGGCTGGCTGCTGGCGGTGAGATTCATGTGACGCCTGTGCTGTTCTCGCAGGGTATCAATGAAATGCAGACGATTGCCAATAACACGGAACGTGCGA
AGACGGAGCTGCAGGATATCATCAACTTCCGCAGTCTAAAGCCTCTGAAGACGTTTTGCGAGAAGTACCGTCGACTTGTGGTAGCTATGCCTGCCAGCGG
CTTGAGTGGTTTATCATCCTCCAGCCGTGGTCGTACCGGCTCGCAGCGCTACAAGGCCATGTCAACGGACTCAACAATCGCATCACCTCTGCATCTCACG
CAAGATGAAGTAACACAGGAGCTGCGCGGTCTTGAAGCATGTATCAACGAAGCTGCGCAGAGTCTGGTCAAGACGAAGCGCACTGAGATTTTGAAGCGGT
CTTCCGACCTATGTCGGGAGCTTGGTGGTGGACGTGTCACGGTGTGCAAGAGTGCCAAGGATCGTACAGCTATGTCTGTGACATTAGAGCAGGTACGTAT
CTTGCAGCGCCATCACGACCTGCCGGAACACCGCGTTCCTGCCACGGTTTCTGTAATGCGTAGCCACGGTGTGCGTATCGAGAACGCGCTCAAGAACACG
GGCAAGCGCCAGTTTGCTTTCAACAAACTGCAGCGGTCGCTGTTGCCGGAGGATTATCGTTGCCCAGACCAAGTGGGTGGCACGGGCAACGTCAGTTAGA
GTGCTCGCGCT