Description :
From Genome Similarity Track
Location :
Scaffold_974:1697- 3135
Transcript NameFunction/comments
Phypl_g11884hypothetical protein

Sequence
1438 bases(100 bases per row)
TTTACCCTTTCGCGGTGGGAGGGCGCATTCCTCGCCCTTTAAGGGTATTCACAAATCACGGTGCGAAAGCAGCTGTCTTAAAGGGCGCATGGTGCGCCCT
TTTAGCTTTTTCTCTACCATGTTTTGTTACTACCAATCACAATGGCTGCTTGGCAAGGGCTGGGTGTAATTTTGGCCGAAAGACGGTTATTTACTGCATC
GAAGACATAATCTATGACCATAAAACGGATCTTGAATCCCGTCGCGTCATAATCTAGCGTACGAAAACGGACCTCACTGATTTTTACCTGCTTTCGCTGC
CATCCGCTGTCCCTATACAACACCTAAGATACATGCACTCCTATCACTCCCCAATGCCACCACAAACAGCGCTGTTGGGCACCAATGAGGACAGACTTTC
AAGACTGGGAGGACAAAAGTCAAGTGCACATAGCGTACCAGTTCGAGCGCGACGAATGCGTTCAAACCGAACGGCTACCCAGCTCCGATTGCGCTTGGAC
AGCCTAAAACGGACGTACGGCAGGTTGATCGGCAGCCCCCCCCTATCATTTCATCGGCCCAGCGTCCCGCTTCCCAACCTAAAGCATGAGAGCAACGCGG
TGAGCGGCGAAGAGGCCGCGGTGAACATGGCGACCGTGGACAACGTGGCagtagtgctgctgctcttgaagGTAGCGAGGTCGCCGTGACAGGCTGGTGT
CGGCGCTCGCGCCTTCATGCTAACGGCGGGCCAGATAGACTAATTTTTGTTGTGTGTGCTGTTGGTGTAGCAGACAGTGAgtgtgctggtggtgggggcC
CTGACGTCGGTGCGGCTAGTCATATCGACGAAGTTGGTGGCACCAGCGCAGTCCCCGCTCCAGGTCGAGGCAGTGGACGTGGTGGGGGTAGAGGACATGA
CGGGCGTGGagaacgtggtggacgtggtgctgacTTTGCAGGCAGCGGTACCGTTATGGCAGGTACGGTGACGGCGCTAGTGCCGTCGTGCTGATGGCGA
GCCAGGTGGACTAACTTTTGGTGAGTGTGCTCTTGGTGTAGCTGGTGGTGagcatgctgctggtgaggCCCTTGCTGTCTGTGGGGCTGGAAATGCCTGC
GATAGCGTCGAGGCTGGGTGTAGTGCATCGACTGATGTGACGCATAGGCAATGGATGTACATGCAAGACGGCATGCGCTGTTCACTGCTCCCGAAGTGGA
GCTTGCTATTACTTCGATTTTCGGCGCCGTTAGCGCTGAGGATGTAGGCCAGTCGGTGGGCCGTACGCACGACAATGCGGGCGAGGTTCTGCCTTCTGGA
ATGGCTGTGTTGATCGAGGCAATCAGCCCTGTGGGCGACAATGATATTTTCCTTAATgttggagctggcgtcggcAACTTGCTAGCTCAAGTCGCGCTTT
CGACAGACGCCAGTGCCTGCGTTGGCATCGAACTTCGA