Description :
From Genome Similarity Track
Location :
Scaffold_1542:1697- 3083
Transcript NameFunction/comments
Physo_145528CRN-like CRN5

Sequence
1386 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAGCTTGTCGTAGAACTCAG
CAGGCTGAATTCCCTCGTAGAGGTGCGACTCCATGTTCTTGCCTTGGTAGAAGCGGTACTTACTGTCTTCCTTGAAATCAGCAGCCACATTCTTTTGGAG
CTTGCCTAGACTGATCTGGTACTGCTTCGCTACCAATTTTTGGTTGGTGGGGTGGGAAATGTTGCTAATGTATACCATGCGCCCCGTCTTGCCACGTACC
TTAATACGGTAGCTACTACCCCATCGAATGGGTTGAATATTTAATCTCTTTAATCCTTCGAGTTCGTATGCAAACATGTTGCCTATATATGCTTGACTAT
ATTATTCTCCGTAGATATGACTTTATAATTATTTGACCTTGTATCAGGATCGACTTTATATCTTAGTCATTTACAAAATATTCTGAAATTAATTAATTCA
TATATTAGGCTTATACCTTTTTGGAGGTTTTAAGCCATTGTCTGACTATATTGGGATTGACTTTTTGAGAAAAAAATTAATTAATTAATTAAGTTCGGTT
TCGTTGTTAGGTTCGGTTTTGCCATCAATAAGTTCGGTTTTGGGCTTTCGCTTGCGAGCTCGCATCTGCTCTCTATTCTTGTCGTTGTAGTCTTTTTGAT
AAGATAAACGAGCTTCGCGTGTGCGCTGCTTTGATACGTTCCTTGCTAGCTTGGTATTGCTCAGGAGAGTATGCCATCATTGTATATTACTAACTTTATA
TTTATTAGGATGAAAAAAATGTCACTGCCCCTTGTGACATCGCCGATGTTCCTTGCCAGCTAAACCAAGTATTAATGGTGAAGCAGAGAATTGGCAGAAT
CGTGTATTATAAGTTTAAAGTACTGTCGACGGACCGCCACGTCAAAATGAAGCTATCCGGTCCTGTAATACTGCTGGGTCCAAGCACGCACGTAGCTAGT
TGTCTTCCGACAGGATGGAGTAAATCATGCCCGCAATCTGCTTCACTGATTCAGGTGCAGGAACGTCATTCTCCATCACCATCATC