Description :
From Genome Similarity Track
Location :
Scaffold_1860:1697- 2857
Sequence
1160 bases(100 bases per row)
CCGTCTGTGTTAGGGCGTAGATCGTACATCGACGACATCCTACTTCGCGCGGAGTCATGGCATCGATTATGTGAACGGGTCAATGATTTACTGGAGGCGT
GTAACAAGTAGAATCTCTCAATCAGCGTGGGGAAGGGCTACTGGGGTATGCGCAAGGTGGTTTATTTGGGACATCGGGTGTCTAAAGATGGGCTATAGGC
AAATCCGAAGGATCTGGCCATGTTAACTGATGTTGATTTCCCGGGATCACTTCGGGCGATGCAATCGCTCCAAGGTAGTTTGAACTACTATGGTCGTTTT
GCTGAGGACTATTCTTTCTTTGCGGCTGTACTGTACAAACTACGAGAAGTGGATTTTGCGGCTATAGCCAAGTCATACGTCCGGATCACGATCGAACAAA
TCTTGGCACAGACCTCAATTCGACGGATCTGGATTAAGTGTCCGATCAAAGAAAGGCAGTCGTAAAATGTGCCTAATCCGGATGAAGAGACCCCCGACGG
CATCCAATCTCGGTGGGTCCGAGCGCGTCGGATGTTCACGACGTTGAAGGGCAAGATCGCGACAAGTCCGATTCTCTGTCATGTCAATCGAGATCGTCAA
GCCGCGCTAATTACCTACACCAGTAATTGGGCTATTTCAGCTACGCTAGTGCAGGAACACTTTTGTCAGTCTAACTCTCAAGCCAACTGAGTTCAACTAT
GGCGTGGCGGAGAAAAAAACCATCGCACTTTTATGAGATCTCGATCTTAACAACAACTTGCTTGCGAGACGATCCATCAGGGTCTTGACTCGACACCCGA
CCTTGGCCTGGCTGATCAATCAGTTGGCCTTCAAGAACGTCTATGTCAGTGAGCAGCCCTTCTCTCGCCTTGGTCTTTGGAGATCATCAAGTGTACGCAT
GGGGAAGACGAGATCTTAGGTGGTGCTGCGGCGATTATTACGCCAATATCCGAGGTAGACGAAGTGTTTTGACCCGGATCGTGCCCAGGAAAGAGCCTAG
ACGCCCGATCCAAACTTTGATTCCGACAGTACGACTGGATGAGCATCTGTACGTGTTAAGTTTTGACGGATCCGCCCGCGTGAAACGCGGTAAGGGCGCT
TACAGCGCAATCTTGTGGAAACTACCAGAATGGACGGTGGCTGTAACGGGGTACGTAGCC