Description :
From Genome Similarity Track
Location :
contig_15:169691- 174862
Transcript NameFunction/comments
g4177.t1XP_008910938.1 choline dehydrogenase [Phytophthora parasitica INRA-310
g4178.t1hypothetical protein
g4179.t1XP_009516894.1 hypothetical protein PHYSODRAFT_473674 [Phytophthora sojae

Sequence
5171 bases(100 bases per row)
GACAAAGTGTCCAGCGTTGGAAGGCACCTGTCGAACGGATAGTTGGGCGCTGCTTTCGACCATGATTTGGTTTGCTGCACGGCAACGAGCATCTACTTGG
AGGTGCAATTACTTCAGGCACAATGCACGTCGGGGTAAATTTATCCCCATTTGCAACGCACGGCTATCGCGGGGAAGGAGGATGTTTCACACGTCAGTAG
CGCGTCCCAACGGAGTGTTGCGGACGTTGATCCGTTGCAGAATTGACGCTACCGCTGGCAGTGTGAAAGACGCCACGAAGTCGTCGACACAGCTGAGGAA
GCAGCGCCATTGAACAGATTGGACCCGCAATCGACTCATAGACCACAACGTGTGCGCTGATACAGACGGTGTGTCTGCCAGTAGACCCGACGTGACCAAG
ACGCTGAACGAGAGCACCTCTCCAAGCTCGTCTGCGCAATCGATTCAAGCTGCAGTCTAACCTCCTGCTGTCGTCTCACAAGGCGCTCAACTGGACAGCC
ATCTGCGCTACTGTACCAGGATAGCAATGGCAGCAGCGCTTCGCTTTTCGTTAGCATGGAGCTCTGAGCTAATAGCGAAGATAGCGAGTGGAAGCGGCTG
GACTCGGCAGGACACCACGCAGCCCACCAACTTGGTGAGCAAGATCTGAGCTTCAGGCGTGTCAACAGCTGTTCAAGATGGCTTCGAACATCCGGCTCTT
TGCGCACATTCCATCGGCGAAACCCCGACTGAGTGCCTTAGTGACACCCAATCGGCGAAATCCCCCCGCTCCTGTAACTTTGTGACATCACGGTACTGCG
ACACATGCGCATAACCGGGTGGTGATCTCCGCTGCGTCAGTAGTGTTGATTCAACACACACAACAGGCACAGAGGCGCTGGTCATGGCTGGCCACCTCAC
AGCGCCACACGCAACCGCGTCTTTGCAGTCTTTACTGGCTGCCAGCGCCACCTGCGCTGCGAGCGTGACCCCGATTTTCCTCCAATCGCATTCGTCATCG
CAGCTCATTGGACCAAAGCCGTTTTTGAGCCCACCCTCCGCGTCATTCGAAGATTGGCTCGCGACCGCACAAGTTGAACTGCCAATAGCCCTGCACAATG
CTGCGCCACTCACTCCGCTCCTCCTCCGTCGCGCGCGCCCCACAGCTGGCCACACGCGCGCTGAGCTCGTCGGCCGCCTCCGCCGAGTACGACTACGTGA
TCGTGGGCGGCGGCTCGGCCGGCTGCGTGCTGGCCAACCGCCTGACCGAGGACCCCAACAACAAGGTGCTGCTGGTGGAGACGGGCCCGAATGACCGCAC
CAAATGGGACTCGTGGAAGATCCACATGCCCGCCGCGCTCACGTACAACCTGGCCAACGAAAGGTACAACTGGGACTACTACACGGAGCCCCAGAAGCAC
CTGAACGGCCGCCGTCTGCCCTGGCCGCGCGGCCGCGTGCTCGGTGGCTCCTCATCGCTCAACGCCATGGTTTACATCCGCGGTCACGCGTATGACTACG
ACGACTGGCAGCAGAGCGGCGCCGACGGATGGAGCTACGCCGACTGCCTTCCCTACTTCCGCAAGGCGCAGAACCACGAGCTCGGACCCGACGACTACCG
AGGAGGCGACGGCCCGCTGCACGTCATCCGCGGCAACCAGAAGGAGCAGATCCTGTTCAAGAAGTTCATTGACGCCGGAGTGCAGGCCGGCTACCCGTTC
ACGGACGACATGAACGGCTACCAGCAGGAAGGATTCGGCTGGATGGACATGACGGTCTGGAAGGGGTTCCGATGGAGCACGGCGTCCGCCTACTTGCGAC
CTGCGATGAAGCGCCCGAACTTGACGGTCGTCACGGACACCTTTGTGAGCAAGGTGGTGTTTGAAGGCAAGAAGGCGGTCGGTGTCGAGACCGAGGACCG
CAAGCAGAAGTCCACGAAGCAGGTCCGGGCCGCGAAGGAGGTGATTCTGTCCGGCGGTGCGATCAACTCGCCGCAGCTGCTGATGCTGTCGGGTATTGGT
GACGCTGGTCACTTGAAGGAGGTGGGCGTGCCTGTTGTGCAGCATGTGCCTGCTGTGGGGCAGAACATGGAGGACCACCTTGACCTGTACATCCAGTACA
TGTGCAAGAAGCCGATCACGCTACACAACGCTACCTGGTACGATCCTAATGGTTTCTGATCACTTTTGTTGCTTGGATGAATTTCTTACTGGTATATTTT
GCTCTTGCAGGAAGTACCCGCACAAGATGGCTGCGATTGGCCTGGAGTGGATCCTTCGTCAGACCGGCATGGGAGCTTCGGCCCACTTGGAATCGGGCGG
CTTCATCCGCAGTGCCCCCGGCAAGCGTCACCCTGACCTACAGTACCACTTCCTGCCCGGCTCGCTGACGGGCCAGCTTACTCCTGGTGCTTACCACGCT
ATGCAAGCCCACTGCTCGCCGATGCGTGCTCAGAGCCGCGGTTGGCTCAAGCTGCGTAGCAACAACCCGCATGAGCACCCGATTATTGAGCCGAACTACC
TGAGCGTGGAACAGGACATCGTGGACATGCGTGCTGGCGTGAAGCTCACCCGTGAGATTCTGGAGCAGCAGACGATGGACGAGTACCGCGGTGACCCGAT
TTCGCCGTCCAAGGACGTTCAGACCGATGCTCAGATTGACGAGTGGGTTCGTCAGAACACGGAAAGCGCGTACCACCCGTCGTGCACTAACCGCATGGGT
GTGGATGACAACACTGTCGTTGACCCGCTGATGCGTGTGCATGGCGTCGAGAACCTGCGCGTTGTGGATGCGTCCATTATGCCGAACATCGTTAGCGGCA
ACCTGAACGGGCCGACGATTATGATTGCTGAGAAGGCTGCCGACATCATCCTGGGCAAGACTCCTCTGCCGAAGTCGACTGCACCGGTGTACCAACCCAA
GAACTGGGAGACCAGCCAGAGATAAGCAAGCAGCTATGCCACCAAACCTGGTTCCCACACCAACGACGTGAGCTGCAATTTTGCGCTCTTCTCTGGCTGC
AGCATTAAATCGGTCTTTTACTTTGACGAAGCTCTACCTGACTGCTGTAGCATTGCGCGAAATGGAAGAAGCCCGAATACACTCCAGATACTGGAGCTGA
TTGCTTTATTTTAATACATGTATAGTACATGTATAGGGCACAAGCTTTGTTTTCCACTTTGTTTTTCAGTACAAGTTGCATTATTGCAGACAAATTTGAC
GTGGTTTCTTTACCCAGACGCGTACATCTGTACTATCTCGAGCTTTGCTACGGAAAATTGGTCTGCTTCTCCTTTTCGGTGCTTGCAGCTGCTGATTAAT
CGACCACTTCGCAACTCGCTCTCTAGTGCTCAAGCTCCGAGACAAGAACAATCATGCGTGTGCACTGCATCATTTTGGCGACCGCTGTCATGCTCCTCGC
CGGCTGCGATTCTGCCTTCGCAGCTACGGACGCTGAGCATACCAGGATCGTGGCGATGATGACGGCTGAAACCTCGGTCTCGACTTACGGTGGACAGAAC
GACGGTGCCGACAACAGGATCCTGCGAGCCGAAGGCACGGTAGACGATACTGAGCTTTCTGCCGAAGACGAAGAGCGTGAATCGGGGGATTTTGTCGAGA
ATGTCAAGTTCTACTACTGGCTGAAGATGGGAAATACCCCCGCAGATATCTATCAGAAGTTTTTCAAGGGCGTGGACCGAGCCATTGTCCTCAAGAACCC
GAATTACGAGGTCTGGAAGAGATACAAAGCATATTATGAAGAGGATGCCAAGTCTGCGTAGTTTTTGTGTAAACGAATCGTCGACCATGCCTGGCATCGT
TTTTTGGAACTCTGCTGCCTGCTTGGCCGACAGTGTCCACTGTCGTATTGTACCAAACGGATAAAGTTCTTTGCGGAGTTGCGATCGTCATTTTCTTCAT
TTGAGAACACATCATACAAACTTGTCCAGAGTTATCAATCACTAAAAAAAAAGCTCGAAAACACTCTTACAAAACATTTGTGGCCTTGAAAATGGCGAAC
AACCTTACAGTGTTGTACTTGTCGTCGCATACACTGCCATTGGAGCGATTCCCGCAGGCATTTAGATCCATGATTTACCCTAACCGATACTAGAAAAACA
TTTTATTCTTCAAGTGTTTAAAGGCAGCGGCTCAGACTCAAAATCTGGGTTTTGGCGGAGTAAACCTGCGAACATGCATAAATGACCTCAATTAAGCGCC
CTACCTGTCAATCTTAATAACTTCAACTAACAAGACACACTCTTTTTCCGCATCAAGGTCTGTCCCGCATCACGGCTCCAGACTGCCCACCACGGACGTG
GAGGTGGACACCGAGGCCGGGCGACAGCAGCGGAGTGAGCAGGAGCTGGGAATGCTCAACTTGGAAGCGCGTAGAAGAACCTATTCAAGGCGCGTAGAAA
AACCTATTCAAGCCTTTGAGCTGTTATCACCAGCCACAAGCATCATGACAAGGCGCGGGAGGGTCGCAGGTGTCGAGAATGACAGCCCCCAGGATGTGGA
CGTCCTCCTGGAATTCATTGGTGATGTTCTGCCGACGGGTGCGAATGAATGGGAGTCAGTGCGGCACAGCTACGAAGACTATGCGGTCGAAACCAACCGC
GCAGAGCGCGAACTGGTGTCGCTCAAGAAGACATTTCAAGCGTTGCTCAACGTCAAGAAGCCAACTGGGGATCCAAGGTGCCCTGAAAATGTCCGGGTGG
CCCGTCAGATCCAGCGCCGGATCGAAGAAAAGGTGCCTGTGGAGAACGACGTTGGCGAAGAAAGAGCTTTGAGCAGTGAAGAGGACAGCCACTCGACAGC
ATCCCACACTCCTCCGGCGCTAAGTGAAAATGAAGGTGACAACTCATGCCATTGCCCGTTTGCACCCTACCTGAGTTCATAGTGCGAAAGCAAGTAGTGA
AAGCAGCTAACATCGCATCCGGTCGTGGTGATAAACGGTCTGTCATTTCCAGCGCCGTAATTCGTCTCCCATGCCGTTCCATATCGTGGCTCCGGGTGGA
GGTCGGCTCTTGTGAGGTAGTGTTGGCCGCGCTGACGATCACGCTTCTCTCTCTGGCCTTCGGCGGTGAGTGCAAGCATCAGAATGAGCACAATGCTCTC
GTCGTTGCCCTCGTAACTCATATTGCTATAGATGCGGAACAAAGTGCTGCGGGTGGGCACGTACTTTTCTA