Description :
From Genome Similarity Track
Location :
Scaffold_194:16962- 23663
Transcript NameFunction/comments
Phyag_g3310conserved hypothetical protein
Phyag_g3311hypothetical protein

Sequence
6701 bases(100 bases per row)
cgctgctgcttgttcatGTTGCGTGCTACTACGTCTCCGTAGGTTTGATCAGCTGTAATttgcagttcctgcagcttcgcagCCAGTTCTTCACAGCCGT
CACTACGATTCCTAGCTCGATTCACttcgtcggagctggacatGAGCACTGGTACTGCACCTCTGAAGCCAGCGATGGTAATACGCGTTGACATCGATGA
TGGTTCTCCTTGCAAATAGCGTTTGGTGAGCTGGAGTTGTTCCCGTTGGCAGTCGACTTTGGTTCCACTCCACAATAATTCCTCCGCCACATCAGGAagt
tgtccagcttcttcaaggCCGGCGTCGCCTTTGAttctcgcttcttcttcgtcgtcggtctcGAATTCGTTCGAACCGACAGAGCTCAGGCAGATTTGGC
TAAGTGAATCGGAGAAGCAATCAGCAGAATTGATCTCCTTGACAGAATTCCACGGCACGAGACCACTTGGCATGGCGTTCGTATCGTTCGATTCATCACA
AGCAGCTACAAACGAAGCACAGAAAGATGTCGAAGCAGTGGTCACGCGAGGTGAACTCGACTTTTGCTTGATGAAGTAGTCTGCGACGACACCAAATTCA
GATTCTGACGGACGTAGATCTGTCATGCGTTGAGCTTTCAACAAGCACATTGGGCAGCAAGGCACAACAGACCACGGACGGCCAACACCAAGAAACACCC
GTTTGTTCTTGACTTGACACTTGGAGCAGATCGGCATCCCGCAAATACGACAACTGCGCAAGTGAGTCCGTAAACCACGTCCACCCCGCTTGATGCACAC
AACGCAGACGGATTTCtttggtggcggcggaaGTTGACTCGAAGTTTGTCCGATATTGACTCGCAAAGCTATACGTCGAGCCAACAGTGTGAGTTTCTTG
GCGTCTGCACAATCCACCAGCCTTCGTTGCCCGCCGATGAAAGCTGATGTCGTATATGGTGACAATACCGAAGCAAACATCTTCCGTTGACCGGACATGT
CGAAGACGCCGCGAGCCAAAACATCGACAAACCCTGGAGTCGTCTCGCGGAAAACACACGTAAAGAAGGCTTTACCACGAACGATGTTGGTGTTTTTGCG
GTCGAACGGTGGTCATTCCGGCAAGTCGACCGAGTGCAGCATGAGGTATCCGTACTGTttgccaccagcatcgacgtcaacTCCCATAGCTTCAAGACAA
CAAATATCTCTCGGTGCACCGATCGATCTCTCGCCATAAAACCACTTGAGACCGAAGTAGTGCACCGGATCCTCCGGTGTTGCCAGTTCGAAGTTGTGTA
GGACTGCAGCGTCCGTCTTGTtcatcaagaacgacaaCGTCGTCCGAGTTTCCTCGTCCGTCGTTCCGGCAAAACCGTACAGCATTTCTTCAATACTCCC
AGGGATATTCCCGATAGCCACGACACTAGGTTGTCCATTGGCGACAGCGCCCATTGCCTGAGGGAAGTCTTCCTCTGCTGCGAGCTCCGCAATTGACCGT
CCacgttgacgacgatgaaaaagCTGCAGACCATCGAACGACCGCACCGATTTCCAGTCTCGGGGAGGAAGACCTGGCAAGCCGTTAGCGAGTCTCTCAT
TGCAGCATTTCTCGTTCGACAAAACTTCATCCAGTCGACGTCGTACCAAGGCACGATACTCGAATCTGCTTTCGGATACTTGAACGTCGGCAAAGTATCC
TTTTGGCAACGGGATCGTCACCTTTGACATCCCGGTTATCGAAATCCGCGAACCAGAAAACGATTCCTCCATGATCCAAACGCTGCGAGTTAGAGACTGT
TGTAAGTGCAACCATCGCCAACGGAACGTAGGGACTATGTCGTCGTAAGGCGTGCTGGATAATGCCACTTTTCCCGTGGGTGGGTGGGTGAGCAGCATTT
CTTTTGCGCCGAAGTTCAGGAATGCCCACGATATCCCACCAAGCAACTTCAGTATACTTTGGAGTACCTTTACGCATTGCGATAGTGTTGGTTGCCAGCA
GAACTGGTTAATAAACGACGATCTACTCCTTAGCTTACATCAACGAATAACTCTAGTCGGTGTTGAAAGGCCCTAGACTGGAGTCGAGTCTTTGCTGCGC
CATTTCATCGGCTTGGTGACCCCACTGACCATCCTTTGCGTCAAACCTGGACGCTTTGGGGCTGTAGAAGATGTAGAATCTATCTGCTTCGTCGGAGCTC
GAGGTGAATCGGAACTtttcaacatcgtcgtcactcaACTCCATGATACTTTCCTTCGACGAGTCTTCGATACCTTCCGAGCTCTCGTCGAACGACGAGT
TGGTCGTCCGATTCATGGACGAATCGAACTTCCGAGCTTCGACCAGCGTCTCTAGTGGACAAGGTCGATGCTGCTTCCAGTCGCCGAACTCGACGATCGA
CTCCTCGTTCAGAGTCCCTGTCCATTGCAACGGAGAAATGAGCACCATCGGGTCTTCAGTTTGAGGCTCggacaacgacaacgactCCATAAAATAGTCG
GCCACAACTGCGTACTCTGGCTCAGCAGGCCGCATGCCTGTCATCTgtcgagcttcttgggcGCAATTGGGACAACAGACACACGCCTTGTGCGGCTTGT
CATTTCCTAGGAACACGCGTTTGCCCTTCACGCGGCACTTGGAACACACTGCAATCCCGCAGATCCGACACCAACGAAGTCTAATACACGAGAACACGCC
CGTCCCAACACGTCGAAGACACACAGAACACAGTCCGTGCTTGGGGTTCTCCTCATCAACGTTCAACGCATCTCGGTTCCTGCCAGAGACGGCGTTGTAA
CGCGCTAACAGCGTGAGTTTCTTGGCATCCGCACAACTCACAATCTTGATGAGTCCACCGACAAACGCCGCAGTGGCGTAGGGCATCAGAGACGCATAAG
GCATCGCAAGCCTCCGCAATTCTCCAGACGTGTCAAAAATGCCTCGTAACACGACGTCGACTACCCCGGGCGCTGCGTCACGGAATatgcacgagaagaa
gagtttgCCACGCAACACTTTGGCTTGAGAGTGATCGAACGGCGGACACTCCGCTAGATCCACAGAATGCAGCACTAAATAcccgaacttctcgtcgctc
gagTCTGTTGCCATACCCATGGCTTCGAGCAAGCAGACGTCGCGGGGTTCGATGATCGGAGCCGACGAATTGTACAACCACTTGAGTCCGAAGAAATGAA
AAGGGTCGTTGGGCGTCGCCAACTCGAACACCCGCAACACAGCGGAATCTGTGCCTGCATCGAGGAACGATGTCGTGGTGCGCATCTCCTCGTAGTTGGT
GTCTGTAAACCCGTAGAGCACGTTCTCCACTGTACCAGCGATACTACCCGTCGCGACGATGCTCGGTTGTCCATTGGCGACGGCTTCTCTGGCTTCGACG
AagtcttcctcctctgcgACTTCATCAAGTGACCgacctcgccgtcgtcgtcggtaGATTTTCAAGTCCTCGTACGACCGCACGTACTTCCAGTCTGCTG
GTGGTAGACACGGCAGTTGGTTGGCCTTCCTGTTCGCGTAGTGGTGTTCGTCATCTAGCAATACATCGAGTCGCCGCTGCACTATGTCCTGATactccag
cttctgcgcTGCAGTCACCTCGATATGACCAAAGTAGTCTTTCGGCAGTGGGAAGCTCAGCTTAGGCGCCATGCTGCACTGCGAATGGACAAGTTGTCAA
GTGACCAGCAAGATCCAGCGAACGGCGCGAAAGACGCCACGCACGAcgagagcacgacgacggccaCCCGTTCCAAGAGAGAGAAAGAAAGCGAGACCGC
TGCAACGACAGAGACCTACTGACGTACCGGTGTCATCAATGCACCGGGTCTTGACACTTGTCAAACTGTTGGTGATCACGGCCATGCTGCACCCGACACG
AGCAGTGCTCGGTGCAGGTTGAAGCTATTATGTCACGTTGCGCTTCAAGCGGTGAGGTTCTATCGTCCCGCACGGTGGGAGTCCGCAGATCGAGAGCCGT
CGCTGACGAtcgtgaagatgaagttggtggTTTGAACTTTGAACGTCACGACACACGTCACACATAGATTGATGTCGGCTTGCTCTACTTGCCGCTTATA
CCTACCTACCGTAGTCGACGCGactgcactcgctgcatcTCGCGCATGGCCGAGTCGttctgctgcacttgacTGCCGATGGACGCAGCTCTCTGGAGCA
ACGCCGCCAATGCGTCCGACGTCGACTTGACTTCCATTTCCTCGGCGTACGGAGGTTCGCGCCACTGCGTGACTGTTTCTACGTCGAGAGcgtagtcgtc
gtcctcttctgcgctggagctgaacCCGTTCACGTCGCTCAAAGTGGACGCGTACCGGTCCATGAAGTCTCGACCCACCCAGCTCTCATCAAGTGTTGCG
TCCGTGGGACGTTCATTGACCTCCTCGGCCACCACTTCGGGAACTGACCCCGTGTCCGTCTTCTCGTCACCGCCCCACCAttcgctgtcgtcgatcTCGG
ATGGGGTAAGTGAGATCATGTATTGTTGCtgagccacagcagcatccaacGCTCCTGAGTACGACTCGAGCGCAGGACCGTGCAGGTAGAagtcggcgac
gacggcgtaTTCCGGTTCAAACGGCCTCATGCCCGTCATCTGCTGCGCGTCCACCACGCAGTTTGGACAGCACACGGCAAACGCACACGGACGCTCGGAC
CCGAGGAACAATCGCTTGTTCTTGGCCGAACACTTTGAGCAGATCGCTACACCACAGACCCGACAAGCCCGTAGATGAGTAGACGAGAACAATCTCTTGC
TACGTTTGATGCAGACGGAGCACACGGCGTCTCGAGCAAAGTCTTCGTCTTGGTTCACGGCATCCAGATTGTATCCGGATACCGAGTTGTGGcgtgacag
cagcgtcagcttcTTAGCCTCTGCGCACTCGACGCCTTTGAGCAAACCGCTGATGAAGCTCATGGACACTAACGGCACCGCGTGTCGGGGCAAGTCGCCG
GACAGGTCGAAAATGCCGCGCACCATGATATCCACGAAGCCCGGTGTGGTTTCACGGAACAGACCGGCGACAAACACTTGTCCTCGGATGATGTCGTTCC
TCCTGCGATCGAAAGGGGGACACTGCAGGATATCCACTGAGTGCAGCACAATGTAGCCGAACTTGTGCTTgttggcgtcttcttcgacgccCATGGCCTC
CAAGTAACAAGCGTCGCGGGGTGTGACGATCGCCTGCATgggcatcttcttgagcacccACTTGAGACCTAGAAAATGCAGCGGGTCCTCGGGTGCGTCC
AATTCCAACACCCGCAGTAGAGCACAATCGGTCGGTTCGTGCATGTAGGCCATGGTCGTCTGTGTCTCTTCCTGCGTCGTGTTGAAGTTTCCATACAACA
GATCTTCGATTGACCCGGGCACTCTCCCCAGTGCAATGATAGAAGGGTCTGGTACGTTGTCGGTTTTCACTTCCGACActtttgctcgtcttcgtcgtcg
gtaCATTTTCACTTCATCGTGAGACCGGACGAACTTCCACTCGTTCGGATCCAGTCGCGGTTGGTGAGCTGCTTTACGTAGGGCGTAGCGTTCCTCGTCA
ACAAGTAACCCGTCGACTCTCCGACGCACCAGCGATCGGTACTCGTCCGATTGCTCGATGGAGACGTTCACCTGGCCGAAATGGTCTTTCGGAAGTGGGA
ACTTGACGCTGGAAGCGGTGGACACATTGGACTCCGAGTGACTCGATTGCATGATAGCGGAGACGTAGCTGAGACGCGAACTGGAGCTCGAACTTGGTGG
TTGCATGCGGGGGGCACCACCAAGGAATTGGATGAAAGAGGAGGGGGGGCACCACGGAGTTTGGGGGTGGTCTCCGAAAGCGGAATCTGGAAGATTGGGG
ATTGGGGATTggcacttcgacgtcgacgtcagAGGGAGGTTGGCAAGTGGCGAGGCTCTGATCCAAAGTCCAGGATGTGTAAGAGAGCCCTCGAGTGACG
GTGCAGGCAATTGCAGTCCAAGGTGTGGGATAGTTCAGACGATGTTAAAATACTGGGGGACGCAACAGTATTGTAGCCTCGTTATTATCAAATCTTCATA
CTGATACACCTTAACCTGGATGACATGGCGTTTAACTTGTTAATATGTTCAGTATTGTAAAATACAAATATGACTTACAAACATGATAATGAGGGATTTG
TAAAACCTTATAGTAATCCTATATTACGGGTTTTCTATTCAAAAAACGCAAAAAAACGCGTATCCGCACTACCCGCGGCTTGACTcacagctgctgctca
aacCGAGGCTGAAAGCACGCAAGACGAGGCTGAGAACGTGCCACAGAGCCGAGCTCAAGGTTTCCACTGCAAGTCTGTAAACGAGCAGGGCCGGCTCAAC
TGCGTTTTGCATTCAACGCTCCTTTTGACTCACTGCAACCTGATCAGGTTCACTCCTGAAGACCTCCCAGATTCCGGTCGTGGAATCCACGTACACGTAC
CACCAACTGCGGTTGTTGATACTTTTCATTGCCATCAGCGTCCTCCGTACTCAACCCCCAAGGCACTGTAATTTTCTTAGAACGAGTTCGTCATTTTGCG
GTCGACTATAGTTCTCGTTAGAAGAAAAAAGTCGGTCTTGGTTGCGGCATTTTGTGCTTGGACGCGAGCACCCCTTCACCGAGACCTTACCAATGCCTGG
T