Description :
From Genome Similarity Track
Location :
Scaffold_107:169540- 176204
Transcript NameFunction/comments
Phyci_174545Hypothetical protein
Phyci_238694Hypothetical protein
Phyci_158864Hypothetical protein
Phyci_95923Hypothetical protein
Phyci_69816Hypothetical protein

Sequence
6664 bases(100 bases per row)
AATCTCATACCTCGCGATATGAGGAGCAACGAGCTGCTGGAGGCTGCTAGGGCGGGTGAGCTCGAGCGGGTGAAAGCTCTGGTAGAACAAGACACTAGTA
TCGATAAGGACAATGCACTGCGATGGGCTGCGAGAGAGGGGCGACTGGATGTAGTGCGGTTTTTAGTGGAGCACGGAGCTGTGATCGACGCCACGGACTA
CCTTGGCGACACGGTGTTGATGAGAGCCGCTGAAGGGGGACACACCAAGATCGTTCGGTTTCTTACGGAGGGTTGTAAATTGGACGTGAATACGTCCAAC
ACGAATGGGATTACGGCTCTGATGCGGGCTGCTACAAACGGACAAGTAGAAGTGGTGCGCTATCTCGCAGGTCAACGCGGGGTTCAGATGGGTGCCAACG
ACAAGTATGGATACACTGCCCTGATGAAGGCGTGCaaagctggatatgtggacattgtgcgatgtctcgctgaagcaggcgcagacgtgaaggatacgga
cgagttcggtcacacaacactgatgATAGCGTCGGGAAGCGGCAACCTCGAGGTTGTACGCTACCTCGTTGAAGATGGTGGCGTCGCTGCGGACTCGAGG
AGCATGCGCGGCGAAACTGCAATCCAACTGGCTGTTGCGGCTGGATATCACGATATCGAGCAGTATCTCAAACCTCTTCTTCTCACATTTCTCATGGACG
ATGTAGGGGGTGATGTAGCAGGAGATGCTGAAGCGTCCGAGATGGATTCATCCAAACTTCTGACGAACAACAACATGGGGCCCACTGAATCATTAAGGCT
GGAGTCCGTTCCGCAACTTGCTGCTACAATGCAAAGACTGCTAACTCGACTACGAGATGAGTCGGAGGACGACGAGTTCACGCGGGTGTTAGTGCGGTTT
GTTTCTTTGTGGAGTCGTCTTGAGCAATTTTTTTTGGCAGATCAATGGCGCGGTCAGCGATGAACACTCCACACAATTCTGCTCCCTTGTTGCTGATGCA
AAAAGAGCTACATTCAAGCTACAAAACATACAAGGAAGATCTAACTTGGAGGCTGTAACAACACAGTGCTGTTGCGCGTTTGAGCTACTTCTGGACAAGT
GTGTGGATGCTATTAACGGGGGAAACAATGGAGACTTAATGTGGGCAGCTAGACATGGTCGAATTGATATAGTTCGTGCTCTTTGTGAAGTCGGCACAGA
CGTAAATGCTCAAGCAAAGGATGGCCGCACTCCGCTGATGATCGCTGCTGAAAACAACGAAATCCAGCTGATTAAGTATCTCATTGAGCGTGGTGCTAGC
ATCACCACCACCGACAGCGTGAGAAATACTGTGCTGATGATTGCCGCCCAAAAGGGACGTAAGGAAGTCTGCCAGTACCTCGTTAAGCTATCTGGCTGCG
ACGTAAATGCCAAGAACTCGTTCGGACATACAGCGCTGATAAGAGCCGCTGCAAACGGGCACATCAATGTTGTTAGACTTCTCGTTGACCAAGGCGCTGA
TGCCAATGCAGCGAGTAAACAAGGTCTTACAGCGTTAATGATGGCCACCCTTAGCGGGTCCAGTgatattgtacgatttctagctgataaacacaaggct
gacatcaatgccaagacaactgatggagataccgtgctgatgCTCGCCGCCTCTGGAGGGCATACTGATGCATTTCTCTATTTCACTGAGGAGCGAGGCC
TTGATCTCAATGCCAAGAACGACAATGGTGACACTGCACTCATGAGGGCCGCTGCAAACGGGAAAGTTGCGATTGTTCGATATATCACTGACCACGGCGT
GCAGTTGAACGCGAAGAACAAAAGAGGATACACAGCGTTGATGAAAGCCACCAAAAGCGGACACGCTGAGGTTGCACAGTGTCTTCTTGAACAATCTGGC
ATTGATGTCAATCACAGAAACGAACGTGGAGAAACAGCAGCCCGTCTAGCTGCTGATCATGGCCACCTAGATATCGAGAGGATGCTTACACCGTTTCTCC
CACCTCGTCGCGAGCAGGATACTGCAGCAATTACATGCTCGAGTGCATTCTCTAGCTGCATAATCCCACCGTCAGAAGTCGACCTCGTTCAATTTTGCAG
GAACGAAAATGTTGGAGGTGAATACCTCGCTGAGTGGTTGGATGCCGACGCTGTCGTGAAACTCAATATTCTAGATGCGTCTCATACGCCATTCAAGGAC
GAAGTATGTTTGTGGCAGCAACTACGGCACCCCAACGTGATGAAAATGTATGGTGCCTGTTTTGCTAGCCCAAATCTacaattctttgtttgtgagtacg
tgagcaatgggtcgctgctcgactgtgtagagttagcttcattgaaaagaccaacgatgtggaaattcctgcacgaggcagcgctaggtcttgaatacct
tcacgagcgcggtattgttcacggtgaccttcaatgcagaaacattttaattggtagcgatggcttagcgaagctgaccaatttcggtttgagtggatca
acgaagcgaccaggTCGTGAATTTTCTGTTGGAGCAAAGCGCTGGCAGTCTCCAGAGGTTTTACAGGGCAAGTCGGCGTCGACTGCGTCGGATATTTACT
CTCTGGGTATGTGCATTTTGGAAGCTGTGACAAGGGAGCGGCCTTGGGGCTGCCAAACTGAGCACACAATGGAGAAACATAAGATGCGCTGGAATCCAGA
GACAGAAGCCAACAGCTTCAGTGAACCAGATTGTTTCCCTGGTGAAGCGCGCAGGTTAGTGTGGCGAATGTGCTGCCAGGATCCTGGTCAACGTGCACCT
CTGGCATCCATCATTTATGAGCTGGAACGTTTAGCTATCACCGACAGTTTAAGCACTTCACAACCGGAATGTGAGCGTGAAGTCGATACTAACCGAATGC
AAAACATCGAAGTGGACGAGTTGTGGCTAGATGTGACAGAATTCATGGATATTAGCGATGAAGACCAATATTGCCGATCATTTGACGCTCTAAAGCGACT
TCGTCTAGCCCTGAAAAACTCTACTACAAGGCTGAGGTTGCTAGAGGAATTCAAGATGCTTCTCACGGATTTTTACCGAATAATCACGATGTCACCTGAA
CAGGCCTCCATGCTGCGGGCTTCATCCACATGGGGTACGATGACGAACATGAATATTTTCCACTTGCGCATTGAATCGGTTTTAGGCTCATTGGAGAAGT
CACAGGGTGAAGAGCGCGAGAGAAACCTACGGTGGCAGCACCAGCGCAATGAACAAGCCGGGGTGTTCTTATCTGAAGTGCAGGATACCTCTCATTTATT
GGACCGCCTAACGACTGCGGAAGAACGAGCGGCGTACCTCAAGTTCCTAAGAACAGAGATGAAAGACCCTAGGCTCAAGTACTCAGCAGAGCAACTTGCA
GTAATGAAAAAGGCATACACAGAAATTGCCTCTACAATCGAAAACGATGATATTTCGCAGCTTATCCCAGAAtggttcatcccgaggttcgaattgattg
tcgacgagtggcggtgtctgggtagcggtgggtttggaagtgtgtaccaagccaagtggctcgattccgaggttgtggCAAAGCTTCTTGGGTCTGCAGC
AGACATGTTTGCGCCTACGGACCAGTCCTCCGAATCAAGCTTGTCGGCGCTACTAgacctttctagcactcaatccacaatggattcgacaaagcgctgt
gaagcaatgtcaacgttccgccatgaagtcgacatctggttcggatttaaccatcctcacatcattcggctattcggcgcctgccacgttggcacacctt
tcttcgtttgtgagtacgctacgaatggaactttgacgagctatctgcaaaagcacccgaatgagttatggacgaagttgcacgaggctgcgttgggtgt
ccagtatctccatgcgcgcggagttgtgcatggtgatttaaaaggaaacaatatcgtgatcgggagcgatatgaaggcgaaggtgacagattttgggttg
agctctatggcaaacaatgacgagataccgcagatttcaggggcgtggcactgggtggcacccgagtGCCTACCCGATATCAACGACGGAGCACAGAATG
CGGCTAACAAACGACCAACAGTGTCATCAGACGTCTACTCTCTTGGTATGTGCATCATAGAAGCGCTACGGGTTGTGGAGAATGTAGAAGATGCCAAGCG
TGGAAAACCCCCACAACCTACTTTGCCGTGGGGTAAACTCGACAATTTTCTTGTGAGATACCATGCCACGAAGGGCAAATTTCCTTCAAAGCCCGCTATC
TGCAGTGACGACCAGTGGGAGTTTATCAAGAAGGTGTGCGCGTTCAGTCCGCAAGAACGAATAAGGATCTCAACTGTCGTTGACAGGTTATCGCAAATTA
CCACTCGGCAACAGAACGAGTTCAAGGATGCCTCACAAATGAAACAAATGAATTCGAATTTCACTCGAGAAACTATTACGGCAGCGCGAAATCTGTTGAA
CTCGTTGCCGGATAACATGGAACGACGTGAGTCGCTGCCCGCTCTGTATGCTTCATTGTGGAATCGGTTGGAGCAGGTACACGAAAGTGTCGACAACATC
CACGAAAGCGAGTGCCAAAATGCATTCTATTCACTGATGCAAGAAGTCAACGAGGGTACACGGATGCTACAAAACATGAACAATAGCCTCGTGAATTTAG
CCGAGACAACAATGCGGTACTATGCGTTGAATCGTCGCCTGGACAAGTTTTGCGACGCATACTTCCGTTTGTTCAAGCAGGGCAGCCAGCCAGCAGCAGC
ACCATGCGAGAACTATTTTGCTCGCTTTATGACTCTTCTCGCAGGTGTTTCGATCTCCCTACGCCAGTCATCAGGTGGAAAAGTGTACTCGTACGCCATG
AAGCTTTTGTATCTGAATATCGTGCTAGTCCAGATTGCGTTTGTTCTAGTTCTTCTCGCCTGTTGGGTGGCGTTCAAGTGAGCCTGATCTTCTAAGGAAG
CCAGCGAACGATGAAACACTTTGACAAGTACGAGTAATTGCTGCTAGCTAAGTCAATAATCAGGAATAAATGGTGCAACCCATCTAGAAATTTGCAGAAG
TCCAAATGGACTAACAGTAGTATTTACGAGAGCTGTTTGTTGCGCAATGCTCGCAGCTGATACACGAATCTTGACAGAGATCACATCTGGTGAACCGCTT
GCTACTTCGGGGATCTGAACAGTCTGGTGCCACGATCCTTAGTTAATTACTTGATGTTGCTCGTACGGCGTTGACGCTTCGACGGAGGATCGTACGCATC
AATTGGTAGTGCCACTACTGCAGGTCGAGTCGACTTGTTCTTGTTAGAACTATTCGCGCATTGAACGAGGTCATCCCACTTCAGCAAAGCACGCGTCATG
CGGTCACGTAAGTCCCGGATCTGCAGCAGTACCTCGCGCTGTGATTGCATCGTTGCCGAGCTGGATGATGGCGATCCTGTTAGCGTCGAGTGCTGTTCCC
AGTCGTCCAGCAATGGTAGAAAACGCTTCCGCATGCGCAGGGCACAATCGGTTAGACTTCGGAACAATGCGTCGTTGTCAGAAGACTCCTTACACACTTG
TTTGGACACCTCGACGGTTAGCTGGTACGACGAGCTACCCAGACCGTATGCTTGAACGATATCATTAATGTCCATGTGGTCGTCAGTATCGTCATTGTTG
TCGAAGGTTCCGTCTTGGGCATCATTGTAATCGTCCGTTTCCACGCTTTCCCATTCTATATCTTCTTCCTCCTCAGAACCATCGTCAGCATCCAATGCTA
TCGCTGGCGGCCCATTTGCGTCTTCCCATTGGACCTTGTCATCCTTTTGGTATTCGCGTTGATCCTTTGACCTTGCACGGTCGGCCACAATGTCACCCTC
ACATTCGCCTCTAAACTTCTCTTCATCCACAATAGCTGCATCTGCACGAGATGATCGCGTCGACTTTTCTTCCTCATCTCCGGAACCACCCGACACGTCA
AAAGCATCCAGCGTCGGCACCAAAATCTCAAAGACACGATTCATCTCCACCAGCACCTGCTCCATCTCCGGCACAAACTGCGCCATCTCTCGATCTCGTT
GCTGCTTCTTGGCTTCACTCACCCGTTCACGATGTCGTATCGTGTCCACCTCCCGCTGTCGTTGCTCCTGCCGTCTCTCTCGCCTCTGCGGGATCACGTA
CCCTCTCTCCATCAGCACCGCATGGCCCGCCACCAGCGACGGATACTTGTGGCCAAAGTCCTGCTTCCACGTCTCAATCAGAGCCAACACCTCCGTCAGC
TGCTTGGACCCCTGCGTTCTGGCTCGCAAGGCCCTCGACACATTGGCACTCGGGTCTTCACCCGCCGCAACCAGCAGCCGATCGAAAAACGAGGCCGTTT
GCTTCGTGATCAGCGCCCGAAACACCACCGACCGCTTGAAAAGCTCATCACACAGCTCCACCGCCTGCAAAAAAGTAAAAAAAAAAAAAAGGATCAGAAA
ATAGGACTCTACACTTCAATACTACATGATGTCTGACCATGGAGAAAACAATAGGGGTCCTGCTCCCTCGCTGCAATTGATGCAGGACAGTTGCAAAGAC
TCTTTGAATGTATTGGGATTGCACCGGAGCTGCCGCGTCGCGGAGAAGACGTTTAAGTTGCTTT