Description :
From Genome Similarity Track
Location :
Scaffold_4:1695133- 1712627
Transcript NameFunction/comments
Phyin_T30-4PITG_03422Putative uncharacterized protein
Phyin_T30-4PITG_03423Dynein heavy chain
Phyin_T30-4PITG_03424GTPase%2C putative
Phyin_T30-4PITG_03425Glycoside hydrolase%2C putative

Sequence
17494 bases(100 bases per row)
CAGCTCACAAAAACTCCACTGGGAACCGTGTCCATGGGCCGATATACGAGTGTGCAGACGTTCAGCGATCAGGACGCACAGGGCGCCGCTGTGGCCTACG
ATGCAACTTCTAGTGCTGCAACAACTTCTGCTACTTCTAGTGACACCAAGGACGGCAAGCTCCACGTAAACCGCGTGGAAAATGTGTCCGGTAGCTCCGC
TGGCGCTGGCAGTGGTGACTTTCACACGTACCGGGCGTCTAGGAGACGGTAGGTAGATGATGCTCCTTTACGTGGAGTGATTATCCGTCTTACAGATTTG
TTGGCAGAGAGATGGAGCGTGTGGCTGCTATGGAGCAGCGCTACAAGGAGAACAAGGAGCAGCAGGAGTTCGAAGCGAAACGTAAACGCAATGCGGAGGA
GTTCGAGGCTAAAATGCACAAACGTGCGGAGAAGCGGCGGCGACGCAAGGAGCGAGCCAAGGCAAGAGATTTGGATGGAGAAGACGAGGAAAAGACCACA
GGCAAGAAGGAACAGGTCCCAGAGACGCCTGGAGGTGTGCCGGAGATCCCCAATGACGGCAGCTTCTTGGAGAAGATGCTGGCTCTACAAAAGGAGAAGG
AGAAAAGCGAGGAGAAATGAACTGATCTCTGGATAAATCTCCGTGTGTATTGAGTTTGTTATATGCAAGGTTTTTAGTTGCTAAGAGTTGCTGGCACGTA
CATACAAGAGCCAACGCGCAGATCCTAATTATCGTCCTGGAAGATAAGCGCGACGCCACGCAAGACCCACTTGGCACTGCCACAGTTGGTCGGCAACGTC
GCCAAGAAAATGTACGTGTGGCCTCGGAAGCGTGTGAGGTACACTGGACACTCGTATACGTTGGGGTCGTGACGCAGGTAGCCCACGGATGAAGGCTCCC
ACGTTGGGGACGTGGTCACAGCCTTGACGTAGATGACAGGCATACTCCAGAGCAGCTCCTTCGGATTACTATCAAGCAACGTACCACCACACTCTGTAGG
TGGTGTTGCACCAACTGGATAACGCTCATTGATCTCGTCCAGTGTACTCCATCGTGCACCCTCTAGGATAAGTCCGTGGACGAATACGCCATCGTCGGGG
TAGTGAGAGACCGTTGAAGGATCTTGAATTGTCGTCACGTGCGTCTCCACAGTCATTTGATTGAGCGGCATGAACCGCTTCCGAGACGTTACTTGCAGGC
ACGCCGTTGTGTAGGCTGTGGGGTTGAAGAGACCTGGTAACCAGATCGAGAATGGAGTGACGAAGCAGCTTCCTCCTCCTCCAGAGGTGTCTCCAGCCCA
CATGACAAGTTGTTCATAACGCTTGACCATGTCAGCGAACCAGCCACTCAGCGACTTTGTCGACGGCCAAGCCTTCTTCTCCCACTTACACTGCGAGAAC
GGGTTGCGTCCGGGCACCTCGTTCAATGACATTGCTGTCGCCAAGTCTTCCATAGCTTGTGACATATTGAGTTGTCCATTCAGTCCCTTCTTGAGGTCAC
CAAGAGATAGCCGGATCTCCTGAAGTAGGACATTCATGCGGCTGCACTCTTGCAATGCTACCACCACGAAAGGACCGTGATCTTCAGTCAAGTGAGGCGT
TGCAGCCTCAACCACGTCCAGCATGTTGAAGAACTCAGGGCAGCGCGCTTCCAAGTCGTCGATAGATGCACGCAATGCTGCCGTCTTGTCGCCACCTCCT
TCTTCTCCACCACCGCCACCTCCAGCTCCTCCACCGATAGTCACGATAGTGTAGCACAATGTTTCACAGGTAGTAGTAAGATAGCCGATTTCAGCATTCG
GGTGAAGACCAAAGAGCGGTGGAGCCTCAGGAACCATATTCTTTTCGATGTAGTTGGCGTAGTCTGCGAACGAGAATTCTTGTGGGTTCGGCGATTTGAA
ACCTGGACCAAGTTCCATGCCGTTAAGAAGCCCTGGGTCAATAAGAACTGCCAGGTATGTGTTGTTTGTTCGACGATCCCAGGCGTCCGTGATGTGGCCG
CCATACATGATCTCGCCGAACAGATAACGCAAGTCATCCCACGGTACTGAAGCGTTGTTGTCCAGGTACGAATGCAGGATGTTAGCACAAATCGTGAGGT
CTCCCGTGTTGAAGCTGTAGGCTCGACTCCATCCTTGTTGCCCAAATCGTCGTCGTCCCAACACAATCGCGTGAAACCAACAGAGCGCGAACAAACAAGC
CTTGAACTCGGCCGGTTTTGTGCACGCCTGTACCTTGTCTTCACCGAAGTTTGCCCATGCACGACGTAAATTCGATTGGATGTCGGACGGGGCTTCGTTA
GCCACCTTGATACAGCTCTGAAGTAGCGACTCAGGAATGTTCAGCATGTCTGGCAATGGAGGTGGTTCAGCAGAGATAAAGCATCGGAAGAGATCATGTG
CACCTTCCGTTGCCACCTCTTCCAGCTGCCGTTCCAGTGTCGGTAACCAGGACTGCATCAAGTGGACATTCTGCAGGATAATCCAGCCACCTTCGGTGCT
CAATCGCTTCAATGCGTCGCCGGCATAGGCTTCCTGGCCTTGGCCCATAGAAATATTGATAAAGTTGTTGTTCTCCAGACTCACCCCGTTCGCTTTTCCC
AGTGTTTCGACCCATGGAGTTGGATCTACACCAGGGAACAACACGAAGAAGATGGGAATACTCGAGTTCGTCTCTGCGTACGTCGCCTCCATGTTGAACG
GTGGCTGAGTCACGTACTCTTCACCCAATGAATCAAGGATGAAGGTTCGCAACGCGTTGGTCACTCGATCAGGTCGCATGGCACGCAGCAGTATCAACCG
TTGGAACGCTGTTAGCTTGATAAAGTCACCAGGTATTTTCTGTCGCTCGGCGTCTTCAGTAGCAAACCACTTTCGCCACTCATCAGGGTCGTTTTGGATG
GCGTCTCCGATCCCAGCGAACGCCTTCAGACTCTCGAGAGCTTTTAATTTCGCCCAGATAGCTGCAGGCAGCCATTCCGAGGCCGAACCAGCGTTACCAG
CATCCGGATGAGCCTTGCTAATGAGGAAATACTCGACTTCTGTATCATTCAGCAGCCCATCTTTCAGCAAGATCTTCAGACACAGCATCGTAGCGACCGT
TAGCTTGTTCCGCTCGAACAGGCCACGACGAACGTAGTTGTAAACGCACGACGTAATGCTATCCATCAGCACTTGACAACGTTCCTTCATCTCCTCATCT
GTGAGATCTGGGACAGCAGGCTCAGTTTCTTCAGCCTCGTCATCACTGCCACCTTCACCATTTTTCCCGCCTTCTGCTGGAGTCTCAACTGCAGCAGCAT
CACCTTCTGCACCTCCATCGACTTCATTCGCGATGAGATTCTTCGCTGGAGGAGCACGATAGATACCAGACAGGAAGACCTGCTGGAACGACGCCAGGGA
GTAGATGTAGTACGAGTGCACCTTGCTGATGTCGTTCATAAGGAAGAATAGTAGGGAGCCTCTTGCAGCGATACTGCGATATTTTTCACTCGTGATGTTC
ACCGACTCTTGCGTCTTCTTCGCCGCCTCCATGTTGTTCTGTGTACGTTGAGCTTTGTGCTTCGTGTCACTTAAAATCTGAATAAGCGGCTGGTTGTTGG
TGATGTCGTCGTCAGCACTGGCCAGGTAGAACAGGATGTCGTCTTCCAGCTTTTTCAACTCGATTTTACCGTTGTTCTGCTCCTGAATCAACTTCTCACG
CTTAATAGCGAGATCTTGGCGTTCTTTGGAGACGGTGAGATTCAGCAACTGATCCTCCAGTCCGAGCATTGTGACAGTAAAGTTGACGATGGTACATTCA
GCTTGGATCTCAGGCGGATAGTGAGGGTTACCCAGCTTCGTGTGTAGATACAAGTGGAAGTTGTCGTTGTACGGTACAGACGCGTCACCAATTTGAATCT
CGTATCGAGCACCACGCCGTGAGGTGGAGCGCTGGATCACTGGCGCCAAAATGGGGTCAATCTTCTCGCCTAGATTCTCGATCAGGAACGCTCCATCGGT
GCCAATAGCTGTCTTCAGACGCTCGATCCACATCTTCTGACCCACGCGCACAATGATGAGATTATTATGTGCTTCCATCTCTCGAATCCAAGCGATTGCT
TGCAGTTGTGGGTCAACGATAAGCGGTCGTCGCCCCATGGATACTGTGGTCACCACAATAGCACCATTCTCGGTTGACACCCGGTCGGATGGCAGCTTTT
GAGTGTTCCATTGTGCGATCTGTGCGTCGTTCGTTAGAATGAGAAGCGGGTTGGCTTCCTCGGACATGGCGATGCTCTCGCCTCCAGCAGCTGTCCGTAG
ATAAGGCACCCAGTGCTTGTTGATCAGTTCGTCGCGGAACGGCTTGGTGAAGGGGCCGATGTAAGAGATAAAGGCTGAAGCAAGCAGCACGTCGCCTACC
AACAAGTCCTTCTCCTTTTGAAGTTGTAACACGTTGATCCCCCATCGAACGTTCTCACTCGATAAGTCATTTGTCAAAGTGCCCGCGAGCTTCATCTTGC
GGTTGCCAGTTTCCACAGCGTTGATGGCGTCTTCCTTCTCCTTCTCGGCTGCAGCAGCTTCGGCAAGTAATTTGTCGAGCTTTGCCTGAAGATCGGCCAC
GAGCGCTGTCACTTCGGTCAGACGAGCATTTGCAGCCTCCAACTCGAGATTGGCAGCAGCCAAAGCTTGACGTTTAGGCTCCACAGTAATCACGATATCG
TAGTACATGACGATGTTGATCACCCAGGAACACAAACCAGCAGCAGCCTTGTTTTTCGTAAGGATCGTGTCGTAGTGAAAGTGCTCCATCTCCAAGAACA
CGCGCACTTCTTTCCAGTTAGTTGGAGGTACTTTACCATCGTCTACCACTTGCTTGAAGCCAACCAGGTACTCGATGTACTCCGGAATATTACCAAGAAG
CTGCTTCTTGACAGTATCCCACTTGACATCCTTCACTTTACCAGTCTTAGTGACCTGTACGTTCGGGTGCACACCAGCTAGCAGCACCATCGTGGCTGAG
AAGACGTCGTCTACGCCAGCAGGAGGCTTCGACATAGTCTTACACTCGCCCAGATCTTTCTTGTTCAACGAGTCCAGAGCAGCCATGGCCTGTGCGACGG
CAGGCTCAGCCTTTGCGAGATCTTCCTGAGTTGATCTCTGCTTCTCCGTGACCTCTGTCTGGATAATAGCACACTTGGCAGCTTCGTCGCCAGCCTTTTT
ACTCTCAGTTTCCACATTAGCTTTCTCTTTGTTGACAGCTTCGGCGATACCAGACGCCACTGCCTTTTTGTCTTCAGCAGCCTCCAGAATGACCTTGAGC
TCCACCTCAAGTCGTGATACTGTGTCTCCCGTTTCTTTGAGTTTCTGCAAGCCTTTCTCTAAGCGATCGATAGCTGCAGCATATTCCTCCACTTTCTTGC
GCAGAATCTTCTTGTACAGCTGTAGCAGCTCCAGATACGACTTCGGTGTCGTGTAGACATGTCGACGTTCGACCTGGAGGAACCGCTCCGCACAGATGTT
TACCGACTGGAACGAGAGCGGCATAAACTTCTCGATACCAGCGCGTGATTCTTCTGATCCAAGTAAGTCTCCAATCTCCTTTAGTTTCTCGCGACCGACA
GACAGCAAAGCTTCCTTAGGCCACGGCTGGAACCAATCGATAACCGTGCAGTTTACAAGAGCAGGGAACTTGCGTGCACGATTACGAAAGTCATCGCCCA
CAGGCGAGAAGCATAGACACAAGTGGAGACGCTTACGGATCTCAGCTTGGAAGAACTTGATGACTTCCTTCCGGTCTTTTGTACCCGCCACAGGCGACAG
TAAGTTGACGATATTGTCCATATCTTCCATGGCAAATAGATCTGGAATCTCTCCAGAGGCTAGCAGATCATTCAAGTAGATGAGGAATTTTTCGTTGGTA
ATCTGAGAATCCGTAAGCATGAACACGACGCCTCCGTCCTCTTCGTTACGAGACAGCATCTCCACCACTGCCATGTGCATCTTGCGTAGATCTTCCTTGA
ATTCGTTCTCGCCGTACTTGGAGCTGATGGTAATCTGACGAACAGTACAGCCACAAATGTGCGAAGCTAGGCGTGCTAATGAGCGCTTACCACTGCCTCC
CACACCGACTAGTAGCGCATGTCCACTCTCATTACGCAGGATACGAACAATACGAGCCACGTGTTTCACAGCATCGTCGAATAGATCTAGCTGCATCGCC
GTGTTGTTCTCGTTGTTGTTGTATTCCCGTAATTGGACTTGCAAGTTCATTTTGAGATCGTCCAAGTTTGTCCCCATGATCTGATCATATTCACTGTCTC
CGTCTTTCGTGAAGTGGCAGAAAATGAGCGGCCAAGAGTTCTCCGCAGCATAATATCGACTCGTGTTACACGACGCGAACGACTTTTTCACTTGCATCTG
CACTAGCTGGTTGTACTTCTCGATATCAGCTTTACACACCAGTCGGTCACCATACACACGCTCACTCTCGTGCAGCCACAGCAGCACGAATTTCTCCTGG
CTATTGAATCGATCTTTCTTGGATGCAATGAGTCCCTGGAACACATTGGACAAGTGGCGAACGTTGAACTCATAGTGGAAATTCGCCGCAGTTTTACGGA
ACGTGCCCACAACACTGGCATGGAGACTCAGCGCAGCCTTGATAAGCGCATTGGAGAACTGTGAATTGCTCAGTTCATCCGCGAATCCCGACAGATGACC
ACCCAGGAACGTCTCATAAATCGTGACGAGACTTGGCGCTTCAGGCATACCCATAGCGAACGTACAGAAATGCCGCTGAAGACGCGGATCGACCAGGAAT
GAGCCGGCTGTTGGGTTCATACCGGAGACCACTTGCGTGTTCAAGATGTTCTGTGTCTGAAGCTTAACTCGGTCAAACCAATGCTTGTACTCCATCACCT
GCCGTAGCAGCGAGATAGCACTCTGTGTGTTGTACGGGTCCACTTCGGGTAGATTCAGATCATCCATGAAGTAGATAAGTCTTGCCTTGCCTGGGGGGCC
CAAATTGATACCAGTTTTACGTTCAAGCTGTCCGAACATGGTCTGCTGTAGAATGGCACTTGTAGTGTAGAAGTTGAAATTGATAGTGCAGTACCGGAAT
GCAGCTGTAGCTTCATCTTTGCTGAGCTTCTTTAGCATACCCATGATGTTCTGCGTCTTACCGGTACCTGCAGGCCCACACACCATCACAGGAACACTCT
TGGAGATTAAATTTTCGAGCCAGAATGCGATTGATGCTGTTTCGGTGGTAGGAACCGTGATCTGGTTGATTGGACTGGGGGATACGTACGTCTCTGTGTA
GAAGTATGGACTCTTGGACCATGAATTGAACTTGGAAGTCTCTGGGTCCAACCAGAAATCAAACACCGTGTTGCTAGCCGAAGCCACGAGCTTCACGTCC
TTCCACTGATTCTTCCACCAGTTGCTGAATTCTGCCGAGTAGTCCGTACCATCGTCACTCATCGTAAGAATAGAGCCAAATGACCACACGCAGCAGAACA
CAAACGTGTTTTGCATCACAGTGTAGTCTTCCAGGACTTGAGGAGTCAACAGACAGTCGATCATGTTCAACAAGTTGGTCACCAACGTCGTCTCTTCCAC
GGGCACAACAGGAACTAGTTTCTTGCGGAAGAATCTGAGCGTCGTCTCAACATACTGATCGAAAAGTCCTTGAAACTTAGCGTGTGTGTCCGGCGTAAAC
ATCATATTTCTCAATCGATGATCAGCCGGTGGCTGGCAGTGGCGATCAAGCCAACTGTCTATCAAGCAGCGCCACTGGTAGCCTTCAGACGTTGAAATGT
ACAGGATACCGGCACGTGACACGGTAGCCGGCGTGGCGTACACCAGATCACGGATCTCGAAGATCATTCGCATGTGCACTTTCAATGGAATACGCTCGTT
CGAGGCCAGAGTCAGCATCCTGTTATCGTCCATGACCGAGTTCATGGACTCGATCCAATTGGCATCAAGGTCTCCGTCTAGAATAATCCACTTGGGGTTG
TTATCTTCATCCCCGTTATCACGACGTCGTGAGCCCAGGTCACGCATGATGCGCGAGAGCAGACCATCTTTCCACTCGCGCGTTTTCAGCACAATGTATC
CGTAGAGTTCGTTGGTACTAACCGATTTCGGGTTCAAATCTTGCACTTCCATCGGTGTGCCCATGATCTCGCGAGCCTTTCTCAAAGTCTTCCACGTCTC
CGTTTTACCCGAAGCAGGAGGTCCCATCACGAAGACGCAGTGACGAATTGCGAGCAGCTCCGATAGCTGCACAACCTTCAGCATAAATTCTGGACGAGGC
GTGTTACCAATAGCTTCTGACGCACCTTGTACCATGGATTCCAGCTCCATATCACGCTTACGAGGAGGATCATTGCGTACGTCTACATTCGGACTGTCGC
GCGGGAATAAATCTCCAAGAAGACCGAAGAAAATCACCATATCCTCTGCGACGATTTTTGGGATGTTAAAGTCTCGCAACGCACGCATGAGCAAATCGGT
CTCCGGAATGTCTGGCTCGGCACGCTTGAAAGCTCCAGCGACGCACAAGACACTCTTGACAGCTCGAAGACCCCAATCGTAGTGCAATTGTTTGGACAGG
AGTTGTCCAAGCAAAGAGTACAAGCCGTAAAACTTCGACGCCAGGATCTTGGCCTGAGTGAATCCTTCTGCCATTAGCATGTTCTCGCAGATCAGCACAA
GATCAGGCACCATGACTGTCATGGGTCGGAACAGAGCCTTCAGTCCTTCAGGCAGCTCGGAGCGTCCAAGATAACCGGGGTTCATAGTAATGAATGCACC
AACTGTAGGGTCTAGCATCACCTCGTCGTTCTCCAAGACAAATTCCTCGTCGTCAGCTTTGCATGCATCGCACACAGCTTTGAACTGGACAGAACACACT
GATAACACCTCTGGTACAAGGCGATTAAATTCATCGAAGCAACCCCATGAGCCGGACGACGCGAGACCTTTGAAAATGTTCCCAAGACTCTTGAAATCCA
TTTCGGGCGAGCAGTTAAACACGTAGCATACTTTTCCCAGAGCATTGGCCAAATCCTTGGTCGTCTCCGTTTTACCTGTACCAGCGGGACCAGCAGGAGC
ACATCCCATTTGCAAGTTTAGTGCCTGTGTTGCCGTCACGTAGATTCGATCTGTCAGTGGGGTAATCACAAGTCGAGGACCGTTTCCAAGGTACTCGTAG
TCGTACGGAATGCCAGCGTCACAGATGAGGATCTGAGCTCGTGCGTTGTTTGCTCCACGGAAGGTCATATCACGCTTCAAGAAACTGCCTGCTGCTGGGG
AGAAGTAGTGCTTAAGCTGAGATTGCCACTGGAAGTGCGTCGCCTCGTCCACTCCTCCACGAATCATATTAGCCACAATGTCTCGACCGTGGGCGTCCAT
CGTAATAAGCACCATCACTCGCTGACGTTCGGCATACGAAATGTTGCTTTGAGTCAGCTTGATCAGGTCCTCGAGTTGTTGCTCCTGCATCTTGTTGTAA
TTTATCAAGGCATCTTTATCACCACCTTGGATGCCACGGAAAGCACGCTCAACTTCTTGAACATAGTGGACTCCTGCTGCGAGCAGGATGATCTGGGCTG
CATCCATGGGCTTATTTGTATCATCCTTAAAGTTAATCCAATCAACACGAGGCATTTCCATGTAGGCAACGAGAGAGCGCTCAATGTGCTTGAATAGCGT
CAATCTCATCGCACGCATGATAGTCTCCAGATAGATCTCGGCCTCTCCTTCTAGCACTGGAGGCTCGAAGAAGTCGACGATTTCGTGACCCACACCGGCC
ACAAAAGACGTTGCGACGGGCCGTTCTCCAGGCCCACGGTCCACGAGTGTGAGCGTCTTTGTTGCCAGGTAGATTTTGGAGCAGTGGGGCATAATACGGT
CCGGATGAGACCCGTTCGACAGGATATCGAGCAGATCTGCTTCGGACATAAAGTAGAAACGAGGAAACTGGCGCCGACGCCCGTCGAGGAACTCTTTCAG
GCGGTGCTTGCATAGCTCCAGCTTCTCCACGATCACCTCTAGACGCTTGATGAGACCGGGCTCGGTACATGCCTCCTGCACATTAAGCGTTATCCAGGCA
GTTTTCAAGATCTGGCGAACTTCTCTATCGATGTCTTCGAAGTCGGACGTCAGCTCGGGCAACTGCTTCTTCACTTCTTCAGACTGGATAAACAGTGGTT
CCAAATAACTCCAGGATCTCTGGATATCACCCAGCAACAGCACGACTTCATTGATGGAGGAAAGACCGATCTGAAGCTTGCCGACGCGAGGCTCGAACTC
GGACTGGTATGGTGACGCACTCATACCTTGCACATCGATTTGGTGGGTCTCAAGGAGCTCAAAGTTTTCTTCTGACACCTTAAGAAGCGGCACGATTTCT
TCTTCTGCAGCACCTGGATTGTATGGTGTCATTTCCCAGTTCACCTCTGCCCACAGAGCCTCGAGCTCGATCAAACGGAGTTCCAGCTCTTGTTCCTTCT
CTGCTTCGTAGCAAATCTCGTTGATGTCTGAGCTAAAGTTGAAGAGATTTTTACTCATAATCAAAGAGAGTCGTTGCTCAGGATCTTCGTCCGGCGTAGG
AAATTCCCCAGTGTGAGCCATGATACGCTTCCAGTGTCTCGGCCGCATGTAGCTTGACCATACACAGCGGATAAGCGGGTGGGTCTTGTCAAACGCCTGG
CATTCCTTCAAGATCGAAGTGTATGCATCACTCCACTGAATGCCTTTAGGGATCTTCTTGAGCTCTTTTAACGCTGATTGAACCTCGATCTGCAGCGCGT
TCACGTCGACTTCTTTAAACAAAATGTCTTGCGTGGCCTTGAAAAACGCCTTTGCACGCTTGATAATTGCCCAGACAGTTTTCATTGCATCTGCATCTGC
ACGCATTAGACCCATCATACGCAGCGATTCATTCATGAGCTGCGGGAATCCAAAGATGGAGCACAGCTTGGTGTTTTCTTCACACTTCCTCATCTCCATG
TTCCAGTCCACGAGGTAGCTTTCGATCTTCTCCAGACCTTTATCAGGCTCCAGCTTAGAGGACCAAAAGTCCAGCGTCTTAAGTGTCTCCATCTTTTGTG
CGATCATCTTCTCGTACGCGATGATCTTTTCCTCAGTCTTCTCGCTGAATATGCGCGTTGGTTCCTGTGTGCGCTTCTCAGTCACTGGAATTTGTTTCTC
GACATCGACGAAGAGCTTCTCCATGTTCTCGATTTCAACCAGCTCTTTATCGACATGGCCTCCGCTCTTCTTGATGCTGAAAAAAAGCTGGCGCACTTGG
TCCAGAACTAAGTGGTTTATATCCTTGTCTACCTCGAGTTTACGGATTATTTCTTTCATCTTCCGCAGAGTTTCCAGTCCGTCCGTATCGTTACTTGGAA
TGTCTTTCCGAAGGTCAACCAGGATTCGGCGGAACTCTCCGTTGCGCTTGTTCATCGTCGCCATAACGCGTCTAATAACCTCGGGCGAGTCGAAGTCCTT
TTGAGTGGCAAGCGGTGGTAATGACTTTGCCTTGTTATCATCTGACGGGGGCTGGAACACCGCAGGAAACGGGGATCCTCGGAGAGGGCCGGCGACACCG
CTGAATGTGCCCATAAAGTCCACCGAAATCTCATATTTCCCTGCTCTAGATGGAGTAAACGTCACCACATACGTGCCATCGTTCTTGTCGAGGATAGAAG
CAACCTGCTCCACTTCGGCTTGAGGATCATCACAGTACTTCAGGGTGATAGCAAACTCATCTCCTCCACAGTCGCGCGGATTGTCGTCCTTGTCTCGAGA
CTGGATGATGAATGTTGTTGGCAACTCGGCCAAGCAGTTGTCGTTAAGCGCAGCGATCAGACACGGACCAAACGCAAGCGACTTTGGAGCTGCTGTGACT
GAGTGGAAGCGAAAAGACGTCGCTACGTTGGTGTACATGCCACCCGACAATGATACTCGAACCTCTGAAGTCAGCGGACCAAACTTCTCATAGCTGGGAG
CGGTAGCCTGAAGAACAGTCGGACTAAGGACAGCACCCGTGACATCGACAGAACCCTTCGCAACCGCAAACCGCAGCGTTGCATTTTGTCCTGTGAAGTT
GAATCCAGTCACTTTTACCTTTGCGCTTCCCGTGATCGGTCCTTGCTTCGGTTCGATCGATGAAATCGAGTACGGAGGTCCGACAATTTCGCTTGCGTTG
AGGACGTGCAAGTCGTTATACCAGCGATTCGCCCACCCTCCAAAGAAGATCAAGTGATTGGTATGTGAATCAAAAACCATGGCAGTATCAGCCCGAGCCT
TCGGTAGTTCACCTTTTACAGGAGGGTTCAACCACACCATACTGCCAGTGTCCAATACAGCAGTGCTGTTCAAGTACGCTCCCTGCGCAGTTCCGGACTC
GGCTAAATCGCCACTGTTGCCTCCAAACAAGAACACTTTCCAGTGTGGTACAGCTGCAACACTGACACACGTGTGGTTCCAGATTGGAGAATACAGTGGT
GTGCTCAACAAACTCCACGTCTTTGTAGGCAAGTCAAAGACGAAGATGTCTTGGAACTGCTTGAAGCTGTTCCATCCGCCAATGACCAACAGTTGCTCTT
TGACCAAGCACGTCTGGTGTCCCGACCGAGGCTCAGGCTTTTCACCGTCCGTTTGAATCTCTTGCCACTTGAATGAATGTAAATCCAACGCGTGCAGGTC
ATTGAAGTCGGTACGACCGAAGCCATTTCCACCATAACCGCCGAACACGTACATCTTCTCACCGACAAGTGTGGCACTATGTGCACCACGGCACTGCGGT
AGCCCTTCCCAGAAACTCTGAGCATACTTCTGCTCCCACACCTTCAGCTCGGTTTTAAAAACCCAGAGATCATTCATTCTCTTTTCAGCTGCAAACCCTC
CGAAGATGATGATGTTCTTCTCATAGAGAATAGCGGAGTGCCGCCATCTTGGAGCGGGTACTTCGTCTTCACTCTGAGAGCTTGTTACCTTGGACCACGT
GTATCCTTGCAATTACATTAACAGCGTTACATTGGTACTAACACATTGCGAGCTGACAGGATTTCCCCTACCATTGCTAGCATCAAGTCGGTACAGTTCG
TTGGTAGGCCCTGGAGGCGATTTGTGATCGCAACCACCGAACATGTAGACTGCAGTCTCTGTGTCCGAGCTTTGCAGTGTGAAAGAATGCCCTGACCGCT
TCACAGGAATCTCTCCATTTTGCTTGGGTGCAATCCACACTAACTCTGGCTCACATCCGTACCCGATCGGCTAACAAATGTCATTTTTAAAACAAAACTA
CTTCGAATCACCGATACTCAAGCTCAAGTACGCACCATCTCGGCTTTGCCAGTGCTGGGGTCTACCTAGAGTGGAATTTTTCTCTCGAATGGAGCTCTTT
TCACGCTGTCGACTTCAAGGCTTAAACTTCTGGTCCTGACAATACTGCCCCCTCACCCTGGATAAAAGCAAAAACCGCTATTCACACACGCGATGAGTCG
GTTCTCGACGCCATTCAAAAGGCGCGACGGGCTACACAGATCCAAGATATTTGTAGTCCCTTCATCACATCCGTTATAGTTAGTCTTGCAGGCAAACGAG
CGCCAACACGCTGCTGTATACCAGAACACCATTGTGCTCAAAGCGCATGCTTTATTTTCATAGCGGAAAGCTCCGCACTCCCTCCCGCTCTTCAAGTCCA
CATGCTCTAGACGCCCATACATCATCTGCAACGGGCACTTAGAAAAGCACGAGCCACTCATAAAAAGGAGTGGAGGCCTTAGCACCACATTGTCCAACTC
AACACCACGGGCAGTTGATCCACTTAGTTGTTGAACTTGAAGAAAATAATGTCGCCGTCCTGGACCTCGTACTTCTTGCCCTGCTGTTTGAGCTTGCCTG
CCTTCTTGACAGCCTCCTCCGTACCAACTGCAGAGTATTAAAAACATTGTTAGACCTCGGTAATCATAACACAGCAGTTAGTAATAGGAAGCCAAACGTA
CGCTCTTTCAGGTCGGCAAACGACTGGACTTCCGCCATAATGAAGCCCTTCTCAAAGTCCGTGTGGATGACACCGGCAGCCTGAGGTGCCAGTCGCCCCT
TGCGGATAGTCCAGCCACGCACCTCGTCCTTGCCAGCAGTGAAGAAGTGGACCAGGCCAAGAGCGTGGTAACCCATGCGGAGCACGCGGTTTAGGATCGA
CTTGTGCGTCGGGTTCTCCTTGAAGTACGTCTCCAGCTGATCAGCAGCCTCGAGATCGAGCAGCTCAAGCTCGAACTCGCAACTGAGCGGGATCACAGGC
TCATTGCCGCCGCGCTCCTTGATGTACTCTGCGATCTGGGGCAGGTACTTGTTACTCTTGCGCAAGTAGTCGCGCTTGCTCACGTTGATGAGGTACACGA
CGGGCTTGGCGGTCAGTAGCTGCATGGTGTTAAGGATCTCCACCTCCTGGGCCGTCCACGTGCCGAAAGACACGTCCTTGCCCGACTCGAGCCACTCCAG
GATCTTGCATAGCGCCTCATACTCGAGCTTCTTCTCCTTGCCGCCAACGCCACGCTCCGCGAGCTTCTTGACACCAGCCGACTCCTTCTTGACGCGCTCA
ATGTCCTTGAGACGCAGCTCCTCCTGGATGATCTTCATGTCACGCACAGGGTCCACGTTGCCCTCCACGTGGGTCACCTCGGTCGAGTCGAAGGCGCGCA
CCATGTGGTAAATGGCGTCCACGGCCTGGATATGCGACAAGAAGGCATTGCCCAGACCAGCACCATCAGCGGCACCGCGCACAAGGCCGGCGATGTCCGT
GATGGAGATGACGGGAGGCACGACGCTCGTGGGCTGGTACTTTTCAACGAGCCAGTTGAAACGCTGGTCGGGCAGCGGCACCACGGCGTCATTGGGGTCG
ATGGTACAGAAGGGGAAGTTCTCGGCAGGGATATGCAGCTTCGACAAGCAGTTGAAGAAGGTGCTCTTGCCCACGTTGGGCACACCCACAATGCCGATCT
TGACATTGTTACCGGGGCGACCCAGGTACGTGCGGGAAGGCTACGGAGGGGTTAAGAGTACCGTTAGAGAATGTCTTACAGTTAGAGAGAAAAGGATCAG
GTTATCATACTTCTTCAGTCTTCTTTCCCTTGGGCGGCATGGTGGCGGACTTCGATGCAGAGTCTTTGAGACGATAAGCGAATGGCGCTGAGCTTGTCTC
TCTTTTGCTTAACCCATGTTCCCGAGGATTAAATTATAAAATTGGATTGACCCTGCTCACTCGTTGGGTGATAAACTTTAAGCAGGTTATAGATAATCGT
CTTTGCTGTCAAATAAACCAAGGAAAGCTTCATTATTGGAAGATGTGAGCAAAACTTGCTCGCTACATTTTACAGCAGACCTAGTGCTTCTACAAAGAAG
CATCAGTCGTTTGGGTGCTGCCTCCAGCCTTCACTTGCTGCGCAAATCTGTCCGTTTCTACATCACATGAGCACGACCATCACAGCGTCAGGGAAACAGA
ATAGCACAATAAGACCACCGAAGAACGACACTTACCAGATTTCTTCTTGGCGGCGGCAACACCAAGGGCGATAAAGACCACCGCCATAACACCCAGGAAC
ACACCAATGCCCACAAAAATCTTCTGAGGGGCTGTGTCCGAGCTACTCAGAGTTGCACAGGAGGTAATGTCCTTTACGCTGCAGTCGGTGCCCGTGTAAC
AGGACAAACAGCTGCACGACATGGTGCCGTTCGATTCCTTGCACTGGCCGTTGCCACCGCAGTCAGACGTGCTCTCGCAAGTGCCACCACCACTAGTAAC
CTCGTAAGAGCCGCAAATGTCCTCCTGGGTCGTACCGACGGTACCTTTAAGAGCAACATCACATTTGCCGCCATCGTCCGTGCATACCACGCCTTCACGG
CTGGAGCACGTCCACGAGTCTGTGCTGGCGATCTTTAGGTTGCTCGCCGAGCAACTGCTCACGATCCAGCCATATTTTGTCGCCAGCTTGTTAGTCGACT
GTGTCTTCGTTTCTACAGAAGGTTTCCACGTAACACTTGGTGCTGTCAGTCCACTCTGCGTCGTCCTTGTAGCCAGAGTACTTTGCAAATTGGGCCTTCA
GGTTCGTGAAATCTGTTGATGCCTTCGAACTGGGCGTTGACAAAAAATCAGTGCTGCCGCCTACATATTGAATTCAAACGTTAGGTTATCCACTCCACTC
AAGAAAGCTGCACACGAATCGTACCTGTGAACATTGGGAACAGCGAGTCCTTTGCGAGCTTGGCTTCACCATACGAGTAAGCCAGGCCACCAGACCAAAC
GGCGGTAAACTCCTTGGTCTTCGAGGGCTCTTGGTACATGTACGGAACCATTCCCCAGTCACGCGGGCTAGCTGAAGAAGTCTTACAGCCATACTCGCCG
AAAGCAACGACGACAGGAATACCCTGCGCCATGTCAATGTAGCGCTGGTATGCCTCTGCAAACGTCGAATCAGGACACCAACGGTACTCATTGATAAGGT
ATATATCAATACTCTCTGCCATCATTCCGTTGGTCATCTTGTCTCCGCAAAGCAGTCCCTGGACCTTCATCACGTGATAGTCGTCTGCGTTGCTTACATC
ATCGTTACTACTGTCAGCCGCAGCGTATGCGAGCGGTAGAAGTCGTATCTTCTTGCCATTGACCGACATCCAATTCTTTAGGTCTGCTACGTACGCCTTA
ACACAAGAGGCAGCCGTGAGATCGGCCTGCATGATTTCGTTGGCCACAACGACGCCCAGGGTGTTGTCGTACTGGGCAAAATTCTGGATAATCTTCTTGC
CATATTCAAGCAGCAGTGCCGGGTAACAGGTCTCAGTCTGGTCCACAGTCTTGGCACCATCGCCAGTGGATACTTTACCCGAGCAACTCAGTTTCTTAGT
GATGGTCGAGTACCGATATTTCCCGTAGTATGCATCGTTGTCAGGCGAGGCCGAGACCATGACGTAGACACCGAGTGCAGCCATGTCATTCATGAACTTC
TTGTACGAAGAACCGGGGTTGATGTTGTACAGACGCAGTGTGTTGTACTTGAGGCCCGCGAGATTTTCCTCGATCACAGCCTTCGAGTACTTGTCATAGT
AGTCATCGCTCACGGCGTACTCGTACGTCAGCTACGAGGCAGATAGCAGTCATCAGTACTAGTATATCCCCATCGAATGCGGAACAGAGCTTTGCTGTTA
GATTGTAGCGGCTGACTCCTTCCTATCTTTTAGGTTTTTTAAGGCGATCGAACGTACCCCTTTGATGAAAAAACGCTCGCCCGACTTGGCATTGTAGAGC
TTGTTGCCGCGCACAATAATCACGCCGTCGACGGCCGCGCCCGCTGTCATGTGCTGCAGTAGCGCTACGGCCGCCAAAACGGCCAGCAGCAGGAGGCTTC
GTCCAGTCATGGGTGTAGCTATCAACCCAGTCAGTCGGCGCCGTTTTCGCTATGGCGACCTCTCCCCTTGCGAACAGAGAACAGCTGGTGTGGA