Description :
From Genome Similarity Track
Location :
Scaffold_83:169511- 174104
Sequence
4593 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTAGGAGAAGTTCGACGACTAATGGATCGAATTGCTCTGTTGGGTAAACCTCTTGAT
GAATATGAAAAACCCGCGATTCTGATCGGCACTTTGCCAGATACTTATGATAACGTGGTTGAAACTTTTCTGGCAAGTCACGTGCCTCGCGATGTCAATG
ATGCACCCAACTACGAACAATTAGAGCATGCGCTTGAATTGGCATACGATCGGCGCCAAGGAAGGAAGTTGGATGCAACCGGTGAAGATCAAGCACTGTA
TGGTGGTGGATATAATAGCGGTCGAGGCCGAGGTCGAGGCCGTGGACGTGGCCGTGGCCGAGGCTCTGAACGCGGCCGTGGAAGTCGCAATGGTGGTCGA
GGACGAGGCCGTGGCACCGGACGAGGAAGACAAGGGCCTGGGCGTGGACGTGGTGAGCAAACTCCCACCGGACGAACTTGTTTTCACTGTGGAGGTACCG
GGCATCAAGTCCGTGACTGCCCTCATCTCGGAAAACGACCACCGATTGATACGCAAGGAAGTGAGCCACCCCAGAAACAAGCAAGAACACAAGGTGCGCA
GCGAAAGCGAGCAGCATCTAAAGGACTTTATGAAAATGATGAGAGTGATGATGCAGCATACGTTATTAGCGCTCTCGCAAACCAGCCACAAGATGTGTTA
AACTTTGCCAGAAAGCGATGGTACTTGGACTCTGGTGCTACAAGCCACCTTACCAATCAGAAGCTTGACTTTGTATCGTTTTCGGGTATGAGTGCATGGT
GCGCGTTGGTGGAAAGAATTGGTTGAGTGTGGCCGGAGTAGGAGATGTGAAGAAGGAGATACAAACTTCTTATGGTCGACGAACATTAATACTGCGAGAT
GTGAGGTATGTACCTGAACTTCAATGCAGTTTGCTTTCGGTACGACGACAAACATCACGAAACCTGCCTGCTGAAGAGAAGGTCAGAATCCATTTTGACG
ACGACAACGTTGCAAAAGTGAAGTTTCAAGAAGGGAATACATACGCACATGTTGATAAGACCAATCTATAATGTTTGGAACTGGAGAGTCCCGTTGATTC
AGCGATGTTAGTTGCTGTGAATGGTAAGCAAGATGTGAAATTATGGCATTCGCGTCTAGGACATCCAGGAAGAAGCGTGTTCAATGCATTATTCCGACAT
ACAGATTGGCCGCTGCCAGACACGGATTTACGAGTCGATACAACATTCAATTGCGAGTCGTGTGTGAAAGGGAAAATGACAAGGAAGAATTTTCACTCGG
TTCAAAGTAATCGTGAATGGTTAGTTGGTGAACGTGTACACATAGATGTTTGGGGACCATATCCAGTCGAGTCGTACTCTGGTAATCGGTACTTTGTGCT
CTTCGTAGATGATGCCAGTAGGTTCTCAACTCTGTTCTTGATGAAAGAGAGGTCTGACGTCTACGAGAAGTTGGAGCTCTATTATGCAAGAGTGAAGACG
CAATTGAAAGTGCGAATGAAGGAGATGCGGTTTGACAATGCTCGCGAGCTAAAAGCTCTTGGAGATAGGTGCAAAGTTAACTACGGAATGGATACTTCGT
TGACTGTGAAGCACACTCCGGAGCAAAATGGAGTCGCAGAGCGAATGATACGCACAATCACTGAAAGAATGAGGTGCTTGCTGGCGCATTTCGGATTACC
ACTACAGCTATGGGCCGAGGCTACTGTCACCGCTGCATACAGCGTGAACACAGTTCCGAACACAACAAGAAGAATGGAAATTCCGTATGCAATTTGGTTT
AGAGAGACACCGGCTTATACGAGGCTTCGTATATTTGGTTGCGCTGTTTTAGCTTATGTTGACAAAGTTGATCGCAAAAAGATGGATGCAAGAGCGAAAG
AAGCTGTATTTGTTGGCTACTCTCGAGAACAGAGAGGATATCGCTTGCTAGATAGCAAGACGAACAAGGCATTTTACAGTCATACAGCGGTATTTTACGA
AGCCAAGCCGGGCCGAATCATGCTTGAAGATGGCACGACAGCGCCAAGTGTCCCAACGTCGGAGTATTTGAATATTGATGTTGATACGATGCA