Description :
From Genome Similarity Track
Location :
Scaffold_652:16951- 18782
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_652-snap-gene-0.5Sodium/hydrogen exchanger

Sequence
1831 bases(100 bases per row)
CGTGTGTCTCGTGGCGCGAGCGCTCAACACGTTCCCGTTGTGCGCACTCGCGAACCTCTGTCGGCGACAGGACCAGCGGATCCCTGTCACGTACATGACG
GTGATCTGGTTCTCGGGCCTGCGCGGCTCGATCGCGTTCGCGCTCGCGCTCAACGTGCGCGTCTCGGGAGACTCGAATCACGCCGATATCCTGCGAGCCT
CGACGCTCTTCACCGTGCTCTCGACCACCATCGTACGTACTTGCTCTAGGACAGCGCAGTTGCCAGTATTCGCAAGTTGCCTTTGCCTTTTCAATGGCTA
TACCGCACTCTGATATTACTTTGTGTGTGTGTGTGGATTGGTGCGTAGCTCTTCGGGATGGCGACAGGGCCACTGCTGCGCGTGCTTCAGCTCAGCCAAG
GAGTCAAGCGGCACCAGTACCAGCACGGCAACACCAACAACACCCCCAGCGACGAGGCATCCGCGCTGATCGAAGAGGCGCCCGAGTCGCTCACCGCAGG
CGGAGTGGTCGGCGAGCTCAAGTACGGCAGCGTGCGCGAGCTCTGGGTGGCGCTCGACGAGACGCACCTCAAGCCGCTCTTCGGCGGCAAGCCGCGTCAG
GGCCAAGCGCCGCGGTAGACGTGACGCCCAAAGCTTATCACGAGGCTCCCATTATGTTGCACTACTGCTGTGGTGTGCGCTTGGGCGATTGCTCCCACGC
AGCGAGAGCGTTTATGCCCGTCCTGTTGAGTCTCCCCTTCTTCTCTGGAAATGGCTGCTGCTGCTACTGTCACTGTCGCTATGCAAGACAAGATGGATGA
GCTTTTTAACAATTAACTGGAACAATCAACTGTCAATCGTGGGTGTGGCAACCGACGAAGCCCCACTGAAACCCTTTGAAGCTACGCGGGACGACCCTCG
CCTCGAATCGCGCTCGTCGCCGCCTTCCAGATGTTCGACGCGGCGTTCGTATCTCGGTTCCACAGCCTGGAACAAGTCGTACACTGACTAGCCCGTGACG
CAAGATATGCCGCTCCTGTACGGTCGAGGGTTCTCGCATTTCCGGAACGTCTCGCACTCGCCCTATTCGTACGCACTGCATCTGCTGCTGGTGCGGAACT
CACCGATCAGGTACACGCTGCAGGCCGCCTTCCGAAACATAAACGACGTCCTAAAGCCCTTGGCCTTGACGGGCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTCGACGACGTGCTTGCCATCGACTCTCACCTGCTTGCGTTCTTGTACAAAGTCCCGATACTTCTTCGCCTTTGTCTCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGCCGTCTTGTCCTTCAAAGGTCCGCAGCCGACAATCTCGTCAATGTATGTCTCGCATTTTTCTGTCTTCGTTTGGATCACCCGCTCGCCG
TAAAGAGCCTTTCGCTTCAGGAGGATGCTGCACCCAATGCCGTCCGTAACAATCTGGTGGTCGAGTGTGTAGCCCTTCGCGCGGAAGCACTTCGTGTTGG
TCTTGAAGAAGATACCCCAGGAGCTCTCTTTGCGGCAGGAGCTCTCGTTGCAAACGTCGAGGTCGTCTCCTTTCAAGTAGTCAGCTTGCTTGTCGTGTTC
CTTTGTGAGGCAAAGCTTCACGAGCGAGGCC