Description :
From Genome Similarity Track
Location :
Scaffold_1212:1695- 4237
Transcript NameFunction/comments
Phymu_g12937hypothetical protein PHYSODRAFT_330841
Phymu_g12938hypothetical protein

Sequence
2542 bases(100 bases per row)
GAGGGAGCAACCCCCGGCGCACGCTCGCGACGGCTACAGCCGCAGCTGCACCCACAGCAGGAGGCAGTGTGATCCAGCGCGTTCGAATCTCCGCGATCTC
GGACTTGAAGGAGTTTACAGGCAAGgatcatgacgaagaacgagcaaGAGCTTGGATAAGCAAGGTCAAGTCTGCATTCTCAAGGGATCAATCCTctgac
gaagagaagtgcCTAACCTTCGGAAATCTGCTCACGGGCCCGGCGAGGAACTGGTACCGGCAACTCGGCAGGTCGACGAGGCTGAAATGGAGCGAGCTGC
TACAATCCTTCCAGACACAGTACTGTGGTCTTGGTGTGCCCGTGGCCTGGCAGTACTACCATGCGCGCAAGCGTTCGGAGGAGTCGCCGCTAGAGTACTT
GTACCCCCTCAACGTCGCCGGCATGCGTGCCCACGTGAGGGTCaaggatggagacgccaaGTCCCCCCGAGAGCATGTCAAGCCCTTCATCGAGACGTTC
GGCGATCAGGATCTCGCAGACCAGCTGACGCTGTTGCGGCTTGCCGACGCCGAACAACTGGAAGACGTATTGCGTGTGCGGTACCGCGCCGAGCCTACGT
GGCAGCGTCGAGTGAGCGGAAGCAAGCGGACGTAACAAAGGAAGCGACCGGATCCCCGGATCCGAAGGCATCGACCCAGACCAGCACGGACTCCACGTCA
CAGGACCGTCGGCCTCGCTATCCCAATGAGGGACAACGTTGCTCGCACCGCGGATCCCGCAAGCACTCGGATCtcggctgctggaagcgcttgacCTGCC
AGAAGTGTGGCAAGAGAGGCCATCCGTCGGATagctgctccttcgtctgcCTCGGCTGCGGAGAGCTTCATGATCATGGCAAGTGCCAGATGGAGGAGTT
CTACAACCTCATTCGGCAGTGGTTCGATCCAAGCAAGCACATGNATCTATGCATATGTGAACAAGAAGTCAATGGATCAAGTTAGCGACAAGCAAGCGGA
TCTATTTGATAATACACGTGAACTGCATGGGAAACGTACGGCTAAAGTTGCAAGCTTCCGCTCTGTGGACGAGTATCAACGAGCTGAAGTCGCCATGGCC
TTGGATCTGATGCCCGGTGAGTCACGCGGGCACTGGAAGTACCATGTACCCAGAaagcacttcaagcaggcgacggcaacgtgcAAGATCAACAACGCCA
AGTCCACCGTGCTTCTTGACTCGGGATCCGAGGTGTCGATCATCGACACCGCCTTTGCTCGTAAGGTTGGATCCCACATCGACACTAGTCAAACACAAGA
ATGCCTCGGAATTGGTGAGCAATTGTACGTTGCAATGGGAAGAACAAGGATCAAGGTTACCTTAGCTGGATACTTGGTGTACTTCTGTGACGTGTGGGTC
GGCGAGGATCTTCCACCAGACTGCGACGCGATCCTCGGTATGGACTTCATGGTCTCGGCAGGCATCCGTCTCGACTTGGGCGACGGATCCGTGTGCCTGC
ACGACGAGGTCCGGATCCGGCTTCATGGACGGCGCCAGATCTTCAGCGGCCGAGCCCGGCCCTTGCTGCTCCAGGAGGGCATCCGTCTTGAGCCCGGCGA
CACGTTCGAGCACCCAGACAGGATCCACCTGAAGGAGTGCaagaagctgtggctgcgaaGGGGAAAGCAGTGGGTACAAAAATTAGTCCAAGGCCCAGGC
AAAGTCCGCTATCTACAACTTACCAACATCGGCGAGAAGGCCATCTCCCTCAACCAcaacgaggagatcggcaTGTGGCTGGCTGGCGACCACGTCCCTC
GCGCCCCAGGCTTCATCTCAGTCGGCTCGCGGCGCTACAACGAGTGGCAGAACCTCGCCGCGAGCGCCACGACCGAgttgccgccgccaccgcgGCCGAA
GGAGCCctgggagctggagccgGCAGTGGAGCGTCCGACCTACACGGAGCCCAAGGCGTTGTTGAAGCGGACGGAGCCGACGGCGGCGCATGTCCACGTC
ACACGTCCCCGCCCTGGCTCTACGCGTGTCAAGTCGGCTACTGTTGAAGCCCGAAGGTCGCCGTCAAATCGCGTGACATGTGGCGACCATCACTCATGGG
ACACAGCCACACGCGACGTTACCGCGTGCCTTGAAGCCCCCAGGTGTGCCCCAGCGACGGGCGACGTATCATCATACGCGCCCAACGCAGACCTTTACAA
CGGTGTGCCGCACGTCTCGCTCCGCGCTCTGGAAGCGAAGCTGCACTGGCAGATATCGACGCTTGAAGATCAGCTAAGGCGTACTGTCTCTGGCCAGAGA
CAGGACGAGAAGTCTGAAGGGTCGCCGCCAAATCGCGTGACATGTGGCGACCATCATTCATGGGACACAGTCACGCGCGACGTTACAGCGTGCCCTGAAG
CCCCCAGGTGTGCCCCAGTGACCGGAGTGGTGCCAACAAACGCGCCTGAGCAGGACCTTTCCAATGGTATGCTCCAGGCGTCTCAACGAAGCCTACAAGC
AGAGCCGACTGTGCcgctgtcactgctggacgatcaGCGTGT