Description :
From Genome Similarity Track
Location :
Scaffold_925:1695- 3573
Transcript NameFunction/comments
g11138.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
GCGAAAATTCCAAATGCCACACTGAGTTTTTACCTGTAAAATGTACGACAAGCCATAAAGAGCCTCTGTTGACCATGAACTAGTACGACAAGCACACAAA
GCCTCTGTCATTGGTGTAATAGAACTATATATTCTGGTGCATACACAATCTGTACCAACGCTTTTCACTTCCTGCACTAACGACAAGCACACACGGCCTC
TGTCAAACTATATCTTTGCCTGTCCAAAGTGGTGTGAGTCCAGAGCAATATGATAAAGTGGCGTAAAGTAACACAACAATTTCGGCAGAATTTTGTTACT
TTGCGAACTTGTTGATAGCAAAGCGGTGTTTGCGCAGACCAAATCGGTGGCGGTCGGTTGCGCGCCAAAACCAAATACGACGTCGGGTGGTTCAGGGCGC
TTCTTGGAGGTGCGTTGGCGGGAAAGCTTGTCCATTGCGCTGCCACTCGTGTCCTAGACCTTACTCCTCAATTTCCGGTCTTCAGCGGAGCTCGCTCCCC
CCTCATCGAACATGCCAAGGAGTCCACACTCTGCTGTCTCCCGCGGTCGTGTTCCCGAGGCTCATCGTGCTGGTGAGGATTGGATGTTTGTTGCCAAGCA
CAACGGCATTTCTCCAACGACGGCCCGTCGGATCGTTGCCAGTGACCGTGAAGAGCCATCGCCTCGTGGAGGCGCACGCAGCGCTTGCATCAAGTGCACC
CCGGAGATAGTGGCAGCTCTCGAAGGGTACCTTAACGACGATTGCACGTACACATGAAGGACATGATTCTGTTCGACTTCGGTGTGAACATCAGCACATC
GACCATATCGGATAGACTCCTGGGGATGCTGTACACGCTGAAGCAGGTAAGATGCTGTAAGTCGCCATGCACTCCAGTTAACACCTCATGTTCTAATGGC
TTATATTATTTGCGATCTAGGTCCGTGTGGAGCCTCAGACGTGTCAACAAGACCAAGCGCAAGCCGTTTGCTGTGGACCTTTGCAAGCATATGGATGCTG
GCGATTTCGTTGTTTACTACGATGAGACGAATTTTAACGTCTATTGCAAGCGCAGCCAAGGCCGCGCGCGAAAGGGCGAACGAGCGACGGTTGTGCTACC
TCCTTCCAAGGGCGCCAATCTCCAGATTCAGTGCGCCGTCTCGACGGAGGTTGGGTTGGTTCACCACCGCCTAGAACGTGGCAGCATCCGTATGGATGTC
AACGCGTCATTCGTTGACGAGATTTACGAAAACGTCAAGGCCTCGCCAACGTTTCAGGAGCATTTCGAGGGCAAGAAGATCGTGGTTGTGCTGGATAACG
CGCCGGCACACAGCCAAACGGAAGAACGGGTCGTCGAGCACGATGACCTCGTTCTTCTCCGCTTAGCGCCATACTCCCCGACGTGCAACCCGATTGAGGG
TTGCTTCAGCGTCCTGAAGGCTCGAATCAAGGCGAACCCGGCGTTGCCGCGAGAGGAACTGGTGGCAAGTCGGCCTCAAGGCCAGATAGCCGAGGGTCGC
ATGCGGATTTGGAGCGCGCTGCCTGACAATGCATTAGCTGCATGGACCTCCGTTTGGTGAACAAGATGGCGTTGCATTGCCAGCATGCTGTTGCAGCAGC
TGAGCGCATGGAAGACATGCAGTACGGTACTTAAACCCGACTCGTTGAGGTCGCCGGCGAGGTATTGCCGCTTTGCTCTGGCTAGTTACCGCTTTACTCT
GGGAATTCAACCCGATTAGTAATCTCACTTTTCAGTTTCAGTTTTCAATTTTCAAATTTGTAAAAAAACGAGTTGCTCTGGACTCGCACCACTTTGGACA
GGCAAAAATGTATATAAGCGAGAACGACAAGTACACAAAGCCTCTGTCATTAAACTTTGTCTTCACAAATACGTACGG