Description :
From Genome Similarity Track
Location :
scaffold_821:1695- 2844
Transcript NameFunction/comments
Pl_102259ABC transporter lipid exporter ABCA1 family

Sequence
1149 bases(100 bases per row)
CAACGCGGTGAATGCTTCGGCTTCCTCGGTATCAATGGTGCTGGAAAAACTACAACCATGAAAATGTTGACTGGAGATGTTCCTCCGAGCAGCGGTACAG
CAACACTAGGTGGCTTCAACATTCTCACAGAGCAGATTGAGGTTCGTCGCCAGATTGGATACTGCCCGCAATTTGACGCCTTGTTCGACTTGCTCACTGT
GCGCGAGCACCTCGAACTCTTTGGTGCTATCAAGGGTGTTCCCTCACATTTGCTGGATCGTGTCGTCATGGAAAAGATTCAACAACTCAACCTCGGCGAC
TTCCAGCACAAGCTGACCGGTAGTCTGAGTGGCAGAAACAAGCGCAAGCTGTCTGTGGCCATCGCCATGATCGGTAACCCGGCCATTATCTTCCTTGACG
AACCGTCCACTGGTATGGACCCTGTATCTCGCCGCTTTATGTGGGACGTCATCGCCGACATTTCCACCCGTGGCAAGGAGTCGACGATTGTTTTGACAAC
GCACAGCATGGAAGAGTGTGAGGCTCTGTGTTCACGTGTGGGTATCATGGTTGGTGGTCGTTTGCGTTGCTACGGAAGCGTGCAGCACCTCAAGTCTCGT
TTTGGTGACGGTCTGATGTTCGACGTCAAGCTTGACACACCAACCCCTGAGGAACTTGAGTACCTGCTCCAACATGTATTTGGTGACGGCAGCACATACG
TTACACCCATGGAGCTGGAAAGCAAGTGTCGTGCATTCGGCAATGCCGACCTTGCTGAGCGTATCACACCTTCTCATCCGACCGGCTACAGTCTTGCTGC
TGCCATGGAACGCGATGGGTTCATTCGTGCAGAAGCGTTCTGTTCCTGGTGTGTTGAGGAAACCCGCTTCGATGTGCTGAACGACTACCTCGTGCGAGCT
TTCGGTGCCGATCAGGTGGTAGTAATGGAGCGCCAGAACGACTTCGCCCGCTTCAAGGTGCGCAGCCACAACAACGAAGTGAAGCTATCTAAGATGTTCG
CTTTGGTCGAGAACGTGAAGACAGATATGCATATTCGCGAGTACAGCGTCTCTCAGACGACATTGGAGCAGATTTTCAACTCCTTCGCCAGCCAGCAAGA
AGAAGAGAAGGGTGTTGCTCGCGGTGTCTTCAAGGAAAAGTAGTTGCAC