Description :
From Genome Similarity Track
Location :
contig_51:169491- 171054
Transcript NameFunction/comments
g10130.t1OWZ20545.1 Protein transporter Sec24 [Phytophthora megakarya

Sequence
1563 bases(100 bases per row)
TACACTCTGCGACAAGATAAATCACCCACCCTCGTTTGAGGGCACAGCTCTGTCAATATTACGAGTTAGCTATTGCTGTTTAGATATGATGCTTCTGTCA
CCAATAGACCAACGTGGTTTGTGCTAACGATTGCAATTTCGCCGCGTGCGGGGGACCTCCAATACAAAATTCCATTTAAGCATAGCGACACATTAGATCA
CCCACTCGAAGCATACAAAAATCAAGTATAAAAGAATGACGGTAATTTCAATAGTGCGTCTTATTGCCTTTCTTATCTAAGACTTCGATGCATCTGCGTG
GCATGGTCAATGAGGGACATCAGCAGTGCATGAGGAATGGATTCCCAAGCCGCAAACAATGCAGCCTTCAATTGAGGCACACTATCAAATTGTCTTCCAT
TTGCATACACTCGCCTACTCATAATGGACCACAAATTCTCAATAGGATTGAGAATCTGGGGATTTTGATGGCCAGTCGAGCAAGCGAATATCTTCTCAGA
GAAAAACTCCTTGGTGCGCTTTGATGCGTGGATGCTTGCATTGTCTTGCTGGAAGATAAAGTCGATACCGTAGTTTAGATGAGCAAAGGGGAGGAGATAC
TCGGAGACAGTGAATCCGAGTTCTGCCTCCCCATAAGAATCACTACCACGCGAGCTGAAGCCAGCCCAAACCATGACAGATCCGCCACCAGCCTGGCGCC
TCTTGGTCTGGCGGGGTGGCTTGCGCAGGTCTCGTCATAGTGCTGGAAGCCATCGGGTCCATCCAGGTTCCACTTCTTCTCATCAGAGAAGTAATGGAGT
ACAGATGACCCCGGTGTCCTTGCACAGTAGCATGGCGCTGGCCCACGCTTTGCGTTTCAGCATGTCCTCGGGCTTGAGGGGGAGCGTGTTCACCATCTTG
GTGTACACCTACCAGTCCACCCTTGCTAGGGTGAGCTGGATGGTGCGCACTGAAACGGTGAGCTGGAGCTCCGTCTTGAGCTGGGCAGCCTACAACATGC
CCTTGGCAGCAGCGCGGATGAGACGACGGGTCTCGCGGTCAGAGAGTGCCGGGGCAGGCCCAGGACGCTTGGCTTCTTGGTGTGACGCGTCTGATGGTGT
ATGTGCAGCGCCCTGTGCTCTTCACAACAGCACGGGCGCTCAGCCCAGCTTCTTGTAGCCCTTGGATACTGCCCTTTTCGCGCTCGGTCACCCAAAGCTT
CTTCTTGCTAGCCTTCTTCATCTTTGGAAAATGATCCGCTCCACTGCACCCAGAGTAGCGATCTCGCAGCGCCAGTCGCTCAAAATGCCAGTTGCACGCC
ACTCATTTTCCAAAATTACCGTCATTCTTGTATACTTGATTTTTGTATGCTTCGAGTGGGTGATCTAATGTGTCGCTATGCTTAAATGGAATTTTGTATT
GGAGGTCCCCCGCACGCGGCGAAATTGCAATCGTTAGCACAAACCACGTTGGTCTATTGGTGACAGAAGCATCATATCTAAACAGCAATAGCTAACTCGT
AATATTGACAGAGCCGTGCCCTCAAACGAGGGTGGGTGATTTATCTTGTCGCGGAGTGTACTA