Description :
From Genome Similarity Track
Location :
contig_15:169452- 174623
Transcript NameFunction/comments
g3993.t1XP_009516884.1 hypothetical protein PHYSODRAFT_309888 [Phytophthora sojae
g3994.t1XP_008910938.1 choline dehydrogenase [Phytophthora parasitica INRA-310
g3995.t1hypothetical protein
g3996.t1XP_009516894.1 hypothetical protein PHYSODRAFT_473674 [Phytophthora sojae

Sequence
5171 bases(100 bases per row)
GCCCAGCCACTACGTTGACGCCGCGCAAGATTCCTTCTCCACTACAGTCCGCTATTTCCAGCGCTTTGCGATGCGACGACTGCGACAGCTTGACGATCGA
CCAAGTGCTTACAGTTCTTGACGTCGGACCGCAGTGCTGAGTGGGCTTTTTCGCCACGAAAGAAATAAATCACTGGAGGACAGCCTTGGCGGAGAACGAA
CTGCTCTTGATGGGGTGAACCGTAAAACGAGACAAAGTGTCCAGCGTTGGAAGGCACCTGGCGAACGGATAGTTGGGCGCTGCTTTCGACCATGATTTGG
TTTGCTGCACGGCAACGAGCATCTACTTGGAGGTGCAATTACTTCAGGCACAATGCACGTCGGGGTAAATTTATCCCCATTTGCAACGCACGGCTATCGC
AGGGAAGGAGGATGTTTCACACGTCAGTAGCGCGTCCCAACGGAGTGTTGCGGACGTTGATCCGTTGCAGAATTGACGCTACCGCTGGCAGTGTGAAAGA
CGCCACGAAGTCGTCGACACAGCTGAGGAAGCAGCGCCATTGAACAGATTGGACCCGCAATCGACTCATAGACCACAACGTGTGCGCTGATACAGACGGT
GTGTCTGCCAGTAGACCCGACGTGACCAAGACGCTGAACGAGAGCACCTCTCCAAGCTCGTCTGCGCAATCGATTCAAGCTGCAGTCTAACCTCCTGCTG
TCGTCTCACAAGGCGCTCAACTGGACAGCCATCTGCGCTACTGTACCAGGATAGCAATGGCAGCAGCGCTTCGCTTTTCGTTAGCATGGAGCTCTGAGCT
AATAGCGAAGATAGCGAGTGGAAGCGGCTGGACTCGGCAGGACACCACGCAGCCCACCAACTTGGTGAGCAAGATCTGAGCTTCAGGCGTGTCAACAGCT
GTTCAAGATGGCTTCGAACATCCGGCTCTTTGCGCACATTCCATCGGCGAAACCCCGACTGAGTGCCTTAGTGACACCCAATCGGCGAAATCCCCCCGCT
CCTGTAACTTTGTGACATCACGGTACTGCGACACATGCGCATAACCGGGTGGTGATCTCCGCTGCGTCAGCAGTGTTGATTCAACACACACAACAGGCAC
AGAGGCGCTGGCCATGGCCGGCCACCTCACAGCGCCACACGCAACCGCGTCTTTGCAGTCTTTACTGGCTGCCAGCGCCACCTGCGCTGCGAGCGTGACC
CCGATTTTCCTCCAATCGCATTCGTCATCGCAGCTCATTGGACCAAAGCCGTTTTTGAGCCCACCCTCCGCGTCATTCGAAGATTGGCTCGCGACCGCAC
AAGTTGAACTGCCAATAGCCCTGCACAATGCTGCGCCACTCACTCCGCTCCTCCTCCGTCGCGCGCGCCCCACAGCTGGCCACACGCGCGCTGAGCTCGT
CGGCCGCCTCCGCCGAGTACGACTACGTGATCGTGGGCGGCGGCTCGGCCGGCTGCGTGCTGGCCAACCGCCTGACCGAGGACCCCAACAACAAGGTGCT
GCTGGTGGAGACGGGCCCGAATGACCGCACCAAATGGGACTCGTGGAAGATCCACATGCCCGCCGCGCTCACGTACAACCTGGCCAACGAAAGGTACAAC
TGGGACTACTACACGGAGCCCCAGAAGCACCTGAACGGCCGCCGTCTGCCCTGGCCGCGCGGCCGCGTGCTCGGTGGCTCCTCATCGCTCAACGCCATGG
TTTACATCCGCGGTCACGCGTATGACTACGACGACTGGCAGCAGAGCGGCGCCGACGGATGGAGCTACGCCGACTGCCTTCCCTACTTCCGCAAGGCGCA
GAACCACGAGCTCGGACCCGACGACTACCGAGGAGGCGACGGCCCGCTGCACGTCATCCGCGGCAACCAGAAGGAGCAGATCCTGTTCAAGAAGTTCATT
GACGCCGGAGTGCAGGCCGGCTACCCGTTCACGGACGACATGAACGGCTACCAGCAGGAAGGATTCGGCTGGATGGACATGACGGTCTGGAAGGGGTTCC
GATGGAGCACGGCGTCCGCCTACTTGCGACCTGCGATGAAGCGCCCGAACTTGACGGTCGTCACGGACACCTTTGTGAGCAAGGTGGTGTTTGAAGGCAA
GAAGGCGGTCGGTGTCGAGACCGAGGACCGCAAGCAGAAGTCCACGAAGCAGGTCCGGGCCGCGAAGGAGGTGATTCTGTCCGGCGGTGCGATCAACTCG
CCGCAGCTGCTGATGCTGTCGGGTATTGGTGACGCTGGTCACTTGAAGGAGGTGGGCGTGCCTGTTGTGCAGCATGTGCCTGCTGTGGGGCAGAACATGG
AGGACCACCTTGACCTGTACATCCAGTACATGTGCAAGAAGCCGATCACGCTACACAACGCTACCTGGTACGATCCTAATGGTTTCTGATCACTTTTGTT
GCTTGGATGAATTTCTTACTGGTATATTTTGCTCTTGCAGGAAGTACCCGCACAAGATGGCTGCGATTGGCCTGGAGTGGATCCTTCGTCAGACCGGCAT
GGGAGCTTCGGCCCACTTGGAATCGGGCGGCTTCATCCGCAGTGCCCCCGGCAAGCGTCACCCTGACCTACAGTACCACTTCCTGCCCGGCTCGCTGACG
GGCCAGCTTACTCCTGGTGCTTACCACGCTATGCAAGCCCACTGCTCGCCGATGCGTGCTCAGAGCCGCGGTTGGCTCAAGCTGCGTAGCAACAACCCGC
ATGAGCACCCGATTATTGAGCCGAACTACCTGAGCGTGGAACAGGACATCGTGGACATGCGTGCTGGCGTGAAGCTCACCCGTGAGATTCTGGAGCAGCA
GACGATGGACGAGTACCGCGGTGACCCGATTTCGCCGTCCAAGGACGTTCAGACCGATGCTCAGATTGACGAGTGGGTTCGTCAGAACACGGAAAGCGCG
TACCACCCGTCGTGCACTAACCGCATGGGTGTGGATGACAACACTGTCGTTGACCCGCTGATGCGTGTGCATGGCGTCGAGAACCTGCGCGTTGTGGATG
CGTCCATTATGCCGAACATCGTTAGCGGCAACCTGAACGGGCCGACGATTATGATTGCTGAGAAGGCTGCCGACATCATCCTGGGCAAGACTCCTCTGCC
GAAGTCGACTGCACCGGTGTACCAACCCAAGAACTGGGAGACCAGCCAGAGATAAGCAAGCAGCTATGCCACCAAACCTGGTTCCCACACCAACGACGTG
AGCTGCAATTTTGCGCTCTTCTCTGGCTGCAGCATTAAATCGGTCTTTTACTTTGACGAAGCTCTACCTGACTGCTGTAGCATTGCGCGAAATGGAAGAA
GCCCGAATACACTCCAGATACTGGAGCTGATTGCTTTATTTTAATACATGTATAGTACATGTATAGGGCACAAGCTTTGTTTTCCACTTTGTTTTTCAGT
ACAAGTTGCATTATTGCAGACAAATTTGACGTGGTTTCTTTACCCAGACGCGTACATCTGTACTATCTCGAGCTTTGCTACGGAAAATTGGTCTGCTTCT
CCTTTTCGGTGCTTGCAGCTGCTGATTAATCGACCACTTCGCAACTCGCTCTCTAGTGCTCAAGCTCCGAGACAAGAACAATCATGCGTGTGCACTGCAT
CATTTTGGCGACCGCTGTCATGCTCCTCGCCGGCTGCGATTCTGCCTTCGCAGCTACGGACGCTGAGCATACCAGGATCGTGGCGATGATGACGGCTGAA
ACCTCGGTCTCGACTTACGGTGGACAGAACGACGGTGCCGACAACAGGATCCTGCGAGCCGAAGGCACGGTAGACGATACTGAGCTTTCTGCCGAAGACG
AAGAGCGTGAATCGGGGGATTTTGTCGAGAATGTCAAGTTCTACTACTGGCTGAAGATGGGAAATACCCCCGCAGATATCTATCAGAAGTTTTTCAAGGG
CGTGGACCGAGCCATTGTCCTCAAGAACCCGAATTACGAGGTCTGGAAGAGATACAAAGCATATTATGAAGAGGATGCCAAGTCTGCGTAGTTTTTGTGT
AAACGAATCGTCGACCATGCCTGGCATCGTTTTTTGGAACTCTGCTGCCTGCTTGGCCGACAGTGTCCACTGTCGTATTGTACCAAACGGATAAAGTTCT
TTGCGGAGTTGCGATCGTCATTTTCTTCATTTGAGAACACATCATACAAACTTGTCCAGAGTTATCAATCACTAAAAAAAAAGCTCGAAAACACTCTTAC
AAAACATTTGTGGCCTTGAAAATGGCGAACAACCTTACAGTGTTGTACTTGTCGTCGCATACACTGCCATTGGAGCGATTCCCGCAGGCATTTAGATCCA
TGATTTACCCTAACCGATACTAGAAAAACATTTTATTCTTCAAGTGTTTAAAGGCAGCGGCTCAGACTCAAAATCTGGGTTTTGGCGGAATAAACCTGCG
AACATGCATAAATGACCTCAATTAAGCGCCCTACCTGTCAATCTTAATAACTTCAACTAACAAGACACACTCTTTTTCCGCATCAAGGTCTGTCCCGCAT
CACGGCTCCAGACTGCCCACCACGGACGTGGAGGTGGACACCGAGGCCGGGCAACAGCAGCGGAGTGAGCAGGAGCTGGGAATGCTCAACTTGGAAGCGC
GTAGAAGAACCTATTCAAGGCGCGTAGAAAAACCTATTCAAGCCTTTGAGCTGTTATCACCAGCCACAAGCATCATGACAAGGCGCGGGAGGGTCGCAGG
TGTCGAGAATGACAGCCCCCAGGATGTGGACGTCCTCCTGGAATTCATTGGTGATGTTCTGCCGACGGGTGCGAATGAATGGGAGTCAGTGCGGCACAGC
TACGAAGACTATGCGGTCGAAACCAACCGCGCAGAGCGCGAACTGGTGTCGCTCAAGAAGACATTTCAAGCGTTGCTCAACGTCAAGAAGCCAACTGGGG
ATCCAAGGTGCCCTGAAAATGTCCGGGTGGCCCGTCAGATCCAGCGCCGGATCGAAGAAAAGGTGCCTGTGGAGAACGACGTTGGCGAAGAAAGAGCTTT
GAGCAGTGAAGAGGACAGCCACTCGACAGCATCCCACACTCCTCCGGCGCTAAGTGAAAATGAAGGTGACAACTCATGCCATTACCCGTTTGCACCCTAC
CTGAGTTCATAGTGCGAAAGCAAGTAGTGAAAGCAGCTAACATCGCATCCGGTCGTGGTGATAAACGGTCT