Description :
From Genome Similarity Track
Location :
contig_15:169447- 174616
Transcript NameFunction/comments
g3369.t1Choline dehydrogenase
g3370.t1hypothetical protein AM587_10005863
g3371.t1Choline dehydrogenase

Sequence
5169 bases(100 bases per row)
TGTCCAGCGTTGGAAGGCACCTGTCGAACGGATAGTTGGGCGCTGCTTTCGACCATGATTTGGTTTGCTGCACGGCAACGAGCATCTACTTGGAGGTGCA
ATTACTTCAGGCACAATGCACGTCGGGGTAAATTTATCCCCATTTGCAACGCACGGCTATCGCGGGGAAGGAGGATGTTTCACACGTCAGTAGCGCGTCC
CAACGGAGTGTTGCGGACGTTGATCCGTTGCAGAATTGACGCTACCGCTGGCAGTGTGAAAGACGCCACGAAGTCGTCGACACAGCTGAGGAAGCAGCGC
CATTGAACAGATTGGACCCGCAATCGACTCATAGACCACAACGTGTGCGCTGATACAGACGGTGTGTCTGCCAGTAGACCCGACGTGACCAAGACGCTGA
ACGAGAGCACCTCTCCAAGCTCGTCTGCGCAATCGATTCAAGCTGCAGTCTAACCTCCTGCTGTCGTCTCACAAGGCGCTCAACTGGACAGCCATCTGCG
CTACTGTACCAGGATAGCAATGGCAGCAGCGCTTCGCTTTTCGTTAGCATGGAGCTCTGAGCTAATAGCGAAGATAGCGAGTGGAAGCGGCTGGACTCGG
CAGGACACCACGCAGCCCACCAACTTGGTGAGCAAGATCTGAGCTTCAGGCGTGTCAACAGCTGTTCAAGATGGCTTCGAACATCCGGCTCTTTGCGCAC
ATTCCATCGGCGAAACCCCGACTGAGTGCCTTAGTGACACCCAATCGGCGAAATCCCCCCGCTCCTGTAACTTTGTGACATCACGGTACTGCGACACATG
CGCATAACCGGGTGGTGATCTCCGCTGCGTCAGCAGTGTTGATTCAACACACACAACAGGCACAGAGGCGCTGGCCATGGCTGGCCACCTCACAGCGCCA
CACGCAACCGCGTCTTTGCAGTCTTTACTGGCTGCCAGCGCCACCTGCGCTGCGAGCGTGACCCCGATTTTCCTCCAATCGCATTCGTCATCGCAGCTCA
TTGGACCAAAGCCGTTTTTGAGCCCACCCTCCGCGTCATTCGAAGATTGGCTCGCGACCGCACAAGTTGAACTGCCAATAGCCCTGCACAATGCTGCGCC
ACTCACTCCGCTCCTCCTCCGTCGCGCGCGCCCCACAGCTGGCCACACGCGCGCTGAGCTCGTCGGCCGCCTCCGCCGAGTACGACTACGTGATCGTGGG
CGGCGGCTCGGCCGGCTGCGTGCTGGCCAACCGCCTGACCGAGGACCCCAACAACAAGGTGCTGCTGGTGGAGACGGGCCCGAATGACCGCACCAAATGG
GACTCGTGGAAGATCCACATGCCCGCCGCGCTCACGTACAACCTGGCCAACGAAAGGTACAACTGGGACTACTACACGGAGCCCCAGAAGCACCTGAACG
GCCGCCGTCTGCCCTGGCCGCGCGGCCGCGTGCTCGGTGGCTCCTCATCGCTCAACGCCATGGTTTACATCCGCGGTCACGCGTATGACTACGACGACTG
GCAGCAGAGCGGCGCCGACGGATGGAGCTACGCCGACTGCCTTCCCTACTTCCGCAAGGCGCAGAACCACGAGCTCGGACCCGACGACTACCGAGGAGGC
GACGGCCCGCTGCACGTCATCCGCGGCAACCAGAAGGAGCAGATCCTGTTCAAGAAGTTCATTGACGCCGGAGTGCAGGCCGGCTACCCGTTCACGGACG
ACATGAACGGCTACCAGCAGGAAGGATTCGGCTGGATGGACATGACGGTCTGGAAGGGGTTCCGATGGAGCACGGCGTCCGCCTACTTGCGACCTGCGAT
GAAGCGCCCGAACTTGACGGTCGTCACGGACACCTTTGTGAGCAAGGTGGTGTTTGAAGGCAAGAAGGCGGTCGGTGTCGAGACCGAGGACCGCAAGCAG
AAGTCCACGAAGCAGGTCCGGGCCGCGAAGGAGGTGATTCTGTCCGGCGGTGCGATCAACTCGCCGCAGCTGCTGATGCTGTCGGGTATTGGTGACGCTG
GTCACTTGAAGGAGGTGGGCGTGCCTTTGTGCAGCATGTGCCTGCTGTGGGGCAGAACATGGAGGACCACCTTGACCTGTACATCCAGTACATGTGCAAG
AAGCCGATCACGCTACACAACGCTACCTGGTACGATCCTAATGGTTTCTGATCACTTTTGTTGCTTGGATGAATTTCTTACTGGTATATTTTGCTCTTGC
AGGAAGTACCCGCACAAGATGGCTGCGATTGGCCTGGAGTGGATCCTTCGTCAGACCGGCATGGGAGCTTCGGCCCACTTGGAATCGGGCGGCTTCATCC
GCAGTGCCCCCGGCAAGCGTCACCCTGACCTACAGTACCACTTCCTGCCCGGCTCGCTGACGGGCCAGCTTACTCCTGGTGCTTACCACGCTATGCAAGC
CCACTGCTCGCCGATGCGTGCTCAGAGCCGCGGTTGGCTCAAGCTGCGTAGCAACAACCCGCATGAGCACCCGATTATTGAGCCGAACTACCTGAGCGTG
GAACAGGACATCGTGGACATGCGTGCTGGCGTGAAGCTCACCCGTGAGATTCTGGAGCAGCAGACGATGGACGAGTACCGCGGTGACCCGATTTCGCCGT
CCAAGGACGTTCAGACCGATGCTCAGATTGACGAGTGGGTTCGTCAGAACACGGAAAGCGCGTACCACCCGTCGTGCACTAACCGCATGGGTGTGGATGA
CAACACTGTCGTTGACCCGCTGATGCGTGTGCATGGCGTCGAGAACCTGCGCGTTGTGGATGCGTCCATTATGCCGAACATCGTTAGCGGCAACCTGAAC
GGGCCGACGATTATGATTGCTGAGAAGGCTGCCGACATCATCCTGGGCAAGACTCCTCTGCCGAAGTCGACTGCACCGGTGTACCAACCCAAGAACTGGG
AGACCAGCCAGAGATAAGCAAGCAGCTATGCCACCAAACCTGGTTCCCACACCAACGACGTGAGCTGCAATTTTGCGCTCTTCTCTGGCTGCAGCATTAA
ATCGGTCTTTTACTTTGACGAAGCTCTACCTGACTGCTGTAGCATTGCGCGAAATGGAAGAAGCCCGAATACACTCCAGATACTGGAGCTGATTGCTTTA
TTTTAATACATGTATAGTACATGTATAGGGCACAAGCTTTGTTTTCCACTTTGTTTTTCAGTACAAGTTGCATTATTGCAGACAAATTTGACGTGGTTTC
TTTACCCAGACGCGTACATCTGTACTATCTCGAGCTTTGCTACGGAAAATTGGTCTGCTTCTCCTTTTCGGTGCTTGCAGCTGCTGATTAATCGACCACT
TCGCAACTCGCTCTCTAGTGCTCAAGCTCCGAGACAAGAACAATCATGCGTGTGCACTGCATCATTTTGGCGACCGCTGTCATGCTCCTCGCCGGCTGCG
ATTCTGCCTTCGCAGCTACGGACGCTGAGCATACCAGGATCGTGGCGATGATGACGGCTGAAACCTCGGTCTCGACTTACGGTGGACAGAACGACGGTGC
CGACAACAGGATCCTGCGAGCCGAAGGCACGGTAGACGATACTGAGCTTTCTGCCGAAGACGAAGAGCGTGAATCGGGGGATTTTGTCGAGAATGTCAAG
TTCTACTACTGGCTGAAGATGGGAAATACCCCCGCAGATATCTATCAGAAGTTTTTCAAGGGCGTGGACCGAGCCATTGTCCTCAAGAACCCGAATTACG
AGGTCTGGAAGAGATACAAAGCATATTATGAAGAGGATGCCAAGTCTGCGTAGTTTTTGTGTAAACGAATCGTCGACCATGCCTGGCATCGTTTTTTGGA
ACTCTGCTGCCTGCTTGGCCGACAGTGTCCACTGTCGTATTGTACCAAACGGATAAAGTTCTTTGCGGAGTTGCGATCGTCATTTTCTTCATTTGAGAAC
ACATCATACAAACTTGTCCAGAGTTATCAATCACTAAAAAAAAAGCTCGAAAACACTCTTACAAAACATTTGTGGCCTTGAAAATGGCGAACAACCTTAC
AGTGTTGTACTTGTCGTCGCATACACTGCCATTGGAGCGATTCCCGCAGGCATTTAGATCCATGATTTACCCTAACCGATACTAGAAAAACATTTTATTC
TTCAAGTGTTTAAAGGCAGCGGCTCAGACTCAAAATCTGGGTTTTGGCGGAGTAAACCTGCGAACATGCATAAATGACCTCAATTAAGCGCCCTACCTGT
CAATCTTAATAACTTCAACTAACAAGACACACTCTTTTTCCGCATCAAGGTCTGTCCCGCATCACGGCTCCAGACTGCCCACCACGGACGTGGAGGTGGA
CACCGAGGCCGGGCGACAGCAGCGGAGTGAGCAGGAGCTGGGAATGCTCAACTTGGAAGCGCGTAGAAGAACCTATTCAAGGCGCGTAGAAAAACCTATT
CAAGCCTTTGAGCTGTTATCACCAGCCACAAGCATCATGACAAGGCGCGGGAGGGTCGCAGGTGTCGAGAATGACAGCCCCCAGGATGTGGACGTCCTCC
TGGAATTCATTGGTGATGTTCTGCCGACGGGTGCGAATGAATGGGAGTCAGTGCGGCACAGCTACGAAGACTATGCGGTCGAAACCAACCGCGCAGAGCG
CGAACTGGTGTCGCTCAAGAAGACATTTCAAGCGTTGCTCAACGTCAAGAAGCCAACTGGGGATCCAAGGTGCCCTGAAAATGTCCGGGTGGCCCGTCAG
ATCCAGCGCCGGATCGAAGAAAAGGTGCCTGTGGAGAACGACGTTGGCGAAGAAAGAGCTTTGAGCAGTGAAGAGGACAGCCACTCGACAGCATCCCACA
CTCCTCCGGCGCTAAGTGAAAATGAAGGTGACAACTCATGCCATTGCCCGTTTGCACCCTACCTGAGTTCATAGTGCGAAAGCAAGTAGTGAAGCAGCTA
ACATCGCATCCGGTCGTGGTGATAAACGGTCTGTCATTTCCAGCGCCGTAATTCGTCTCCCATGCCGTTCCATATCGTGGCTCCGGGTGGAGGTCGGCTC
TTGTGAGGTAGTGTTGGCCGCGCTGACGATCACGCTTCTCTCTCTGGCCTTCGGCGGTGAGTGCAAGCATCAGAATGAGCACAATGCTCTCGTCGTTGCC
CTCGTAACTCATATTGCTATAGATGCGGAACAAAGTGCTGCGGGTGGGCACGTACTTTTCTAAATCTGT