Description :
From Genome Similarity Track
Location :
Scaffold_307:16943- 18803
Transcript NameFunction/comments
g17055.t1XP_011616105.1 PREDICTED: uncharacterized protein LOC101063318, partial [Takifugu rubripes
g17056.t1hypothetical protein

Sequence
1860 bases(100 bases per row)
CTTCTTTGAAAGTCGTCGCAAGGCAGGGCAAGTGCGGGAATCGAAGTCCCTGCACAGCGCGCCCACGTTCTGTGTCAAGAAGCCACAGGGCGGGTGGCGC
ATCGTTCATGCGTACAACAAGCTGAACGACGCGACGGTACCGGCGCAGACGCAGATACCTCGAAAAGATGTGATCATCGATTCGATGGCCTCGAGTACTA
TCTTCAGTACTCTTGATCTGAGAGACGGGTTCTATCAGATCCTCATGCATGAGAGCGATATCCCTCTCACAGCGGTAAGTACTCCGAGCGGCATGCTCTG
GGAGTGGCTCATTATGCCACAGGGTCTGGAGAACGTCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGC
TATTTCGTTGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAGATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAA
AGCACAAGCTCTATGCAAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCAC
GTGTATGAGGAAGCGTAGGTGTAATTTACTTAAGTTCAGTATACTTGTATCCGTAAGTATACTTAAACTTAGATAAAGGAACCGAACGATAGCTTTGGTG
CCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTTTAATGAGAGATTCTGCCATCGGATGGCTGGCAAAATCCCTATCTA
TTGAATGACGCTCATTGGTAAAAAGATGTTACTTTCTACCAGTCATATGCTTTTGCTATGAATGTGAACCACCCTGTGGAGTGGTCAACCTGAATGTATC
CATTAGTGCATGTTACACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACACCATCCCCCCGTTAGGATTTGACGTGCCGGTCTCGACACGTCAA
TCCGTATTTTCTTCGGGAGAACACGTGCTCATTCCCAATGAGCACGCCAATGACGTCTTCGTCTAAGACACCAGCCACTTCGGCAACAGCTAGTGCTGTT
GTCGCCTCCAAGGCGACGACGGCCGCTGCCTCAGCCACGACCGCTACTGGCATCGCCTCGACGGCGATGTCGACAAGCGCGGCAACAGGGAGTCGCCTCT
CTGTTGCTGGATACCACTCGAGATGGCATGAGAAACATGCCATCCGAAACAAGACAGGCAAGATCATTGCTGTCGAAACCGGAGTGGGTATCTACTCTCC
GGGTGGAGAGGGAGTTCCCCTCGACTACGGAAGCGAAGTCGAGGAGGGGGAACTCGAAGGAGACAAGGACACCTTGTCTCCGGGCCACACTGACCCCAAT
GTGGGTCTGCGTCGTCCACGCGAGGACGACTCGAACGCTTCGGGCTCGAAGCGCTCGCGCAGCGGCAGTGGAACACCGCTTGCTGCCGCTGGAGCCTTAA
CGACTCCGCGGGATGGAGATGACTTCACTCCATCCGCTGTTGTTGCGGCCTCGCGCACTGAGCCAGTGCGCGAGCCGTGGATGCCGTCTCAATTTGAGAT
CGGCAGCCGATTCGGTGCGACCGTGCCACCGAATCTGTACGCGCTGTATTCGTGCAACGCCATCGTTGACGATGACGTCGCGAAGGGGTTTCACTTTGAT
CCGATGACGAACCAAAGGCGCGACTACTACATCGGACTTTCATGAGCTCCGATGGTTTCGAGCAAGAAGACTTCTCGCAGAAACAAAGTACCCGAGTGAC
AGGCACTTTGTCAGAGTTGGAGTGCCTTTGTTGAGAACTTCAACAAGAACCCCGTTAGCT