Description :
From Genome Similarity Track
Location :
contig_51:169421- 170985
Transcript NameFunction/comments
g10586.t1hypothetical protein

Sequence
1564 bases(100 bases per row)
TACACTCTGCGACAAGATAAATCACCCACCCTCGTTTGAGGGCACAGCTCTGTCAATATTACGCGTTAGCTATTGCTGTTTAGATATGATGCTTCTGTCA
CCAATAGACCAACGTGGTTTGTGCTAACGATTGCAATTTCGCCGCGTGCGGGGGACCTCCAATACAAAATTCCATTTAAGCATAGCGACACATTAGATCA
CCCACTCGAAGCATACAAAAATCAAGTATAAAAGAATGACGGTAATTTCAATAGTGCGTCTTATTGCCTTTCTTATCTAAGACTTCGATGCATCTGCGTG
GCATGGTCAATGAGGGACATCAGCAGTGCATGAGGAATGGATTCCCAAGCCGCAAACAATGCAGCCTTCAATTGAGGCACACTATCAAATTGTCTTCCAT
TTGCATACACTCGCCTACTCATAATGGACCACAAATTCTCAATAGGATTGAGAATCTGGGGATTTTGATGGCCAGTCGAGCAAGCGAATATCTTCTCAGA
GAAAAACTCCTTGGTGCGCTTTGATGCGTGGATGCTTGCATTGTCTTGCTGGAAGATAAAGTCGATACCGTAGTTTAGATGAGCAAAGGGGAGGAGATAC
TCGGAGACAGTGAATCCGAGTTCTGCCTCCCCATAAGAATCACTACCACGCGAGTTGAAGCCAGCCCAAACCATGACAGATCCGCCACCAGCCTGGCGCC
TCTTGGTCTGGCGGGGTGGCTTGCGCAGGTCTCGTCAGTAGTGCTGGAAGCCATCGGGTCCATCCAGGTTCCACTTCTTCTCATCAGAGAAGTAATGGAG
TACAGATGACCCCGGTGTCCTTGCACAGTAGCATGGCGCTGGCCCACGCTTTGCGTTTCAGCATGTCCTCGGGCTTGAGGGGGAGCGTGTTCACCATCTT
GGTGTACATCTACCAGTCCACCCTTGCTAGGGTGAGCTGGATGGTGCGCACTGAAACGGTGAGCTGGAGCTCCGTCTTGAGCTGGGCAGCCGACAACATG
CCCTTGGCAGCAGCGCGGATGAGACGGCGGGTCTCGCGGTCAGAGAGTGCCGGGGCAGGCCCAGGACGCTTGGCTTCTTGGTGTGACGCGTCTGATGGTG
TATGTGCAGCGCCCTGTGCTCTTCGCAACAGCACGGGCGCTCAGCCCAGCTTCTTGTAGCCCTTGGATACTGCCCTTTTCGCGCTCGGTCACCCAAAGCT
TCTTCTTGCTAGCCTTCTTCATCTTTGGAAAATGATCCGCTCCACTGCACCCAGAGTAGCGATCTCGCAGCGCCAGTCGCTCAAAATGCCAGTTGCACGC
CACTCATTTTCCAAAATTACCGTCATTCTTGTATACTTGATTTTTGTATGCTTCGAGTGGGTGATCTAATGTGTCGCTATGCTTAAATGGAATTTTGTAT
TGGAGGTCCCCCGCACGCGGCGAAATTGCAATCGTTAGCACAAACCACGTTGGTCTATTGGTGACAGAAGCATCATATCTAAACAGCAATAGCTAACTCG
TAATATTGACAGAGCCGTGCCCTCAAACGAGGGTGGGTGATTTATCTTGTCGCGGAGTGTACTA