Description :
From Genome Similarity Track
Location :
Scaffold_419:16942- 18197
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_419-fgenesh-gene-0.6Pectin lyase

Sequence
1255 bases(100 bases per row)
GCCGACGTCAAAGTTGATGGTGCTGAGCGTGATCTTCTTGGCCACCGTGGGGGTGTACACCGCGACGCCCTTCATGCGCGCGGCCGCCGTGCTGTCCTGG
TTGCCCGTGAGCGCGCCAGAGTTGGAGAAAGCGTTGGCCACGCAGGCGCGGCCGAGGTACTGCGTGCAGAGCGTCTGGGTGGCCGTCGTTGGCACCAACA
CGCTGCCCGTGGTCGAGCTGTCGTGCAGGCTCGGGTCCGTCGTGTCCTGGAAGTAGTTGCCCTCGATGAGCACGTGCGCGTCGCTCTGGACCTCGAACGA
GAAGCCCGAGTTCGAGTACCAGTAGTTGTTGGCGGCGTGGGCCACCACGTCCGTGGTCACGGCCTTGAGGCCGCCGAACTTGGGCGAGCGACCCGACGTG
TGGTGAATGTAGTTGTTGAGCAGGTTGATGCGCGTGGCTGAGCCCTCGATGATGAAAACCCAGTAGTGGCGCCCGTCGCAGGTCGCCGAGTAGGGTGTGA
CGCCGTCAAACTCCGAGTTGGAGATCGTCAGGCTCTTGCAGCTCGCGGCGTTCGTGGTCATCATCTGGCGGCCCACGAGCGAGATCTTGACGTGGTCGAT
CCACACGCGCTCCTGCGTGGCGCCCGAGCTCGCGCCCTGGAGGTAGATCGCGTCGCCGCCCTAGATCAGGTGCGGGTTGAGGTTCGTGACGTGGATGTTC
TGGACGATCACGTTGTTGCCTTGGATCCAGAGGCCCTTGCCGATGATCACGCCCGAGAGACCGTCGCCGCGCAGTGTCTTATTGTCGTTGATGATCAGCG
GGTTCTTCGTGCCAGCCACGTCGTACGTGACGGCCACGGACGTGCCTTCAATGCAGCCGCCCGTGTTGGCCATGCCACCGCTCTGGAGGATCACGTCCTG
GCCCTTGAAGCCGTTGTTCTTGGCGAGGCACTGGCGGTTGGACAGCGGACGGCAGCTTAGCTCGGTCTTGGAGCCCTTGGAGCCGCGAAAGTCGAACGTC
TTGTTGAGGATGATCACGCGCGGCTGCGAGTCCGAGAGGTACGACTTGAGCTGCGCGATCGTCGTCGGGTACACTGGCGCCGTGTTGCCACCGCCAGTGG
TGCCCGCTGCGAGACCCGGGGTCGAGCCCGTGCTGATCGCCGAGACGGTCTGGACCAGGACAGCGGCGATCATGAGGAGGCCGACGCGAAAGAGCTTCAT
GGTAGGTAGGTAGGTTGGATGGGAGCTGCTGATGTTGTTGCAAATTGCAGAATGA