Description :
From Genome Similarity Track
Location :
Scaffold_63:1694- 2810
Transcript NameFunction/comments
Sapdi_VS20SDRG_13720hypothetical protein
Sapdi_VS20SDRG_13721hypothetical protein

Sequence
1116 bases(100 bases per row)
GACGAGGATGGCGCGATACCCGAGGATGAGGCCGCCGGACGAGACGACCGTGACGAGCGTCGCAGCGGCAAAGAGCACTTCGCGTGAGAGCGTCATCGAT
GTCATGACGCCGATTTGGAAATGGGGTCAACGGCAGTCCAGAAGATGATTATTGGCTTTTCGTCCCTATACAAAATATGGACGCAGAACACTGGACGCAA
AATATTCCTTCGAGCACCTGGGCGAAGCGGACCAGAGACAGGCGTGTCACGCGTGCTGTGTTTTCCAAGCTCTGCGAGTCCTCTCGGAGGGTCTTTTGCG
ATGAAGTCCGCGTCGGAAAGACTCAATTGTACATATTTGCGTGAAGCGACCAGCACGAGCGACCAAGCAAGGCCCACGTTGTCTTCCCACTTCAGATATT
GCGAGCGACTAGCTACTGTAGTCGTTGTACTGCTTGTGCTTGCGTATGGATTGCCATCGATGACATATTCGACGCTGCACTTTGAGCGGGAAGATTGCGC
GCCGGTTCGAATTTCCACCGATGCACCAATCCGTGCGTGGTATCTTGTTGAATTTTATCCAATGAAATCATTTTCGGAATTTGCAGCCAAGGGCCCATGT
CGTACTTCATCCCGCCGGTCAACTATGGCATGATCGAGGAGGACCTCTACCGCAGTGGCATCCCGAACGAGCTCAACTTCCCCTTCCTCGAGCGCCTGAA
CCTGCGCAAGATCGTGTACCTCGCGCCAGAGGAGCCCAACCCGCAGCTCTTGAGCTTCGTCGAGGAGCAAGAGATCGAGCTCGTCGTTCTCGGCGGCAAC
ACCAAGCTCGAGAGCCGCCGAAAGGCGTGGGAGCCCATGAGTGAAGAGACAGTCCTCGCCGCCCTCGACATCCTCCTCGACCGCTCCAACTACCCGCTCT
TCTTGACCTGCCACCTCGGCCGCGACCGGACCGGCGCCGTCGTCGGCTGCCTCCGCAAGATCCAGCAGTGGCACCTCTCGTCCATCTTTGAGGAGTACCG
GCGCTTTGCCGGGTCCAAGGTTCGTCTCCAGAACGAGCAGTTCATCGAGCTCTTCGACACGGACCTCGTGACGATCCCGACCAATCCGCCCAACTGGATC
AAGACCCACATGATCG