Description :
From Genome Similarity Track
Location :
Scaffold_32:169360- 170688
Sequence
1328 bases(100 bases per row)
CTTCTTCGTTAACAACGCGCGACACCCGCGTGTCCCTGCTCTCCTCGCCGTGGGCCATCCCACAGCGCCGTGTGTCTCCACTCTGGGTGGGGAAGAAGCT
GCCGACAAGCCGTCTACTCCATCTGCGATGTCTCCGGCGGCTACACCGGTACTGGGTCAACGTGTATATACACCGGTTGCTAATGATATCTCGAGTGTAT
CCCCTGCTCCCACGTCGGTCAACGCAGTGACACGCTCCGCATCGAGCTCACTTGCGCCAGCTAACTACGCGCCGAAGCATGCGGCGCGACCAATCGACTC
CGCAGTCGTCTCCGACTTCGTACTACAGCGCCAAGCGGTCACCCGCTATGTTCGTGACGCACTGCAGGACGCAGTGGACAAGCAGAAGGAGAACGCTGAT
AAGGCTGGCCGCAAGAACACAGCCACGTTTACGACAGGCGAACGAGTGCTCCTGTCGACTGAAGGTATCAGAAACTCTGCGGTTACCAACCTCGGCGCGA
ACAAACTCGCGCCGCGCTTTATTGGGCCGTTTACGGTGATCAAGACCATTGGTGACGCTTACACTCTGGATATTCCTTCGACACTACGGCTACATCCGAC
GTTCTACGTCGGACGTTTAAAAAAAATACCATCCGTCCGAGATCCCGGACGCTGATTTGTCCTCGAGTGACGCGGCAACTTTCCAGCGAGATGGTCCTCC
TCCTTTGATCGACTCTTCGGGCGCTCAGCACTGGATCGCTGAGCGAATCGTCGACCATGACTTTCGCCCGTGTCATGGTACCCGTGACGGTCACACTGAG
GCGTTTCCACAGGGTCGCGCCCTGCGGGAAAAGGAACAACACTATCGCGTGCGTTGGCTGGGACTCTCCCCAGGTGAAGATCCTTGGGAGCCGCGCAGTC
GCTTGCGGGAAGACGTTCCCGACATCGTGAACGAATACGAGAAGACACTCACGTTCCGAAGCGTGAGTGAGCCGGGTGCTGATATCCGCGGTGAAGAAGG
CGACCAGCCTGCGCGGGTACACGGAGGCGCTCGCCATGATGATTAAGAAGAAAACTGGAGTTGACGCCGGGATCGAACCGGTGACCAGCTATACGAGAAC
TCGGCACTGTACCGCTGAGCCACTCGGTGAGTAAGCCGAGTGAACAAGTGAGTAAGTAAGTGAGTGAGTGAGAGCGAGTGAGTGAGTGAGTGCGGCGTGA
GTGACACGAGGTTCCACGACGACGAGTGAAACCCCAGCTCGCAGGTCACCTATATTCCGACGTCGCAGTCGCCTGGGTCTACAAGATACTTCTTCGTATG
CTGTGCAGTCGCACATCGTCGCTCAGTC