Description :
From Genome Similarity Track
Location :
Scaffold_330:16934- 18363
Sequence
1429 bases(100 bases per row)
TGTGGTCGGTAGGATAGGTACGCTTGCAGAGTGCAACTCGATGCGTCTCGCAGTAATCCGTTTTTCTGGGTGGCATCCCTGCCCTCGAACTTACAAACAG
TGCATTTGCGCATTGCCCGACTCCTTCCTTGTAAAACAATCCACGATTCTTTTGCTACACATGGTATGTGCTGGCGTATCTAGCTCATTCGTCTTTCTGG
TAAAATTGGCAGCAGTTGCCATGGGTTTTGTGTTCGAAGTGTACACAATTTCGTCATCACTGTCAATGCACTTCTTCCAATCTCCATTGAATAATTCTCG
CACAAGTGAAATGACAAACGCCCTGTGGCTGCCACGGGCGCTTGCCCTCGCATTATTGCGAGGCTGTGCAACATCCATCTCGCTTGTATCACGTGCCAAG
TTATCGCATGCATACGCACTACACCTCGCGATATCAATCATAGCCATTGCTAATTTTTTATGCCACTTCTGAAATGAGTGACCATCGGCTAGCGAAAACC
GACCGTGAAGCTGATCATGACGATGGACTCCCTGCATCCCCGCGTTGTATTCACCGATGCAGGTCGGGGCTTTAAACGCAACACGTTCCTCCTTTATGCG
ACGATATACCGTAGAGGAAGAGGAGGCGTCAGCATTAGAGACTACATTCACAATAGAGCCATATATCCAACTGGCCGCTACGATATGTTTCTCTAGGCAT
ATGCCTTGTTTCATGTAGCCTCTAGGCTTTCCATCAGCTTTTCGGATCATTGTGAAATGGAGAAAGTGTTTGCTGGTGTGCACACTGTACCACGACCATA
AAGGCCGATCGACCTTAGCGATTCTAGTAGCAGGCAAGAGGTATAGAAATTATCGATATTTACAACGCGATTAGATCCTTTCAAAGATTCCACAACTTCA
ATTACGTGAGAACGAATTTCAGAGGTCTTCGCGGTAAGATCGACAAGCTGTAATATCTCTGGACTTGGGACCACGTCATCCAAACGGTCTTTTAATTCAC
TTGCATAGTGCAATTTGAAACGCACGACATATCATGATGTCGAACAGCAACAAGCATAAAACCTGAAGTGATATTTCCCTGTCGGTTTTTGGGGATTGAA
AACTATAATATGGCGGGCGTATTGCGAACAACACGCAATACTAGCTTCATCTACAGCCACGTCTCGACCAACTTCAACATAACGCATGCACCGAGATTTC
AATATGTTGATAAGAGGCCTATGCTAGCTGCTGGGTCGCGCTTGATATCCAAACTCGAAACTTTGGAGCGAAAGCTCAAGTTCTTGCGAATGTAAATAAA
CCTTCTCCACGTCATAACTGATTCTAGACAAGTAGAACGAGCTCCGGGGGAAATGCTAGCTTCGTCGTCATCAACCTAGTAATTTCTCATCTCCCCCATG
TCGAACAGAGTCATGTACCACATAATCCC