Description :
From Genome Similarity Track
Location :
Scaffold_95:16925- 17967
Sequence
1042 bases(100 bases per row)
CTGCCTAGCCCATAAAAAAGAAGGAGACTTGGCACGGGTAAAAATCATGGCCTGCCATGCACGCAGTCAGTCTTAAAGGCCCACTTTTCCCGCAAAATGC
TTGATACGTGCCTTCTCTGTAATGCTATTAATTCTAACATATTCTTTGCGATTTGCAGCTTTAAAATGCCACCATCGGACGTCTTCATCTTCTGAAGTGG
ACGTTCTATGAGAAGCTGAAAATGGCTGGGGGAAGTTAAGGCTGAGTGCAACTACTGTTCACTTGGTTTGCAACCACAAATTTTTTGCAAGGAAGTCCTC
GTTGCACAGGTATTCCGCGTTGTACTGCTAATCATTTGCGATATATCTACTAACAGCATGACACAGTCGTACATAGATGCTCCTATTAAGGCGAACTTTA
AGGCTGAGAACCTTGGCAGCAACTGGTCGAAAAAACTGTTTCGGTGTGCGCATTGTGTATGCAGATCTCTTTTCTTCTACATAGTGACTAGCAAATTCCT
TCCGGCACGATTTTTCCATCGCATTTTGATGTTTTCGCTCGGTCCGGCCACCCTACATAGTGAGAACCTGCTTTATGGAGCTATAATAACACCTGTAACA
CTGTTAAAAGCAGGATGAAACGATATTAACTGGTCAAAACAATTAAAGCTGGTAAGAAGTGGTGGTAAGTGGTAATAACGTTAAAAACTTGGTAAATGTG
CTAACAACTGCTAGAAAGTCACAGAGCTTTTTACCTAACATCCCTATCCATCAATATGATGAGCACTTGTTTGAACCCTTGTTACTTCATTGATATCATT
CACCGCCATCAATATGATGAGCACGCCCACCATGTCCTCGATGGAGCAGATCCAGGTATTGTACATGATGCTGTTCCTACAGCTGCCGATTTAGTATGGA
GCTGTGAAGAATCTGTACCAGCTGGTCCATTCAGCATGTAGAAGAATGCGTAGCTGTGGTTAAGCTCTACGCCGTACACCAAGGCTTCGCCGTGAGAATT
TACCGTACCAAATGATATGGATTCAATCGCGTCTCCCCCTGC