Description :
From Genome Similarity Track
Location :
Scaffold_2:169218- 170881
Transcript NameFunction/comments
Aphas_H257_00993myosin-like protein

Sequence
1663 bases(100 bases per row)
ACACGTATACGGGCAAGATCTGCATCGCCGTCAACCCGTACCAGTGGCTCCGTCTGTACAGCCCCGAGACGATGCAACTCTACATGGACGGGTCCCGCGA
GAACAAGGCGCCGCACGTGTACGCGGTGTCAATGGAGTCGTTCTTCCACATGCGCACGCACACAATCAACCAGTCGATCCTCGTGAGCGGCGAGTCGGGC
GCGGGCAAGACCGAAACGACCAAGATCATGATGAACCACGTCGCGACGTTGGCGTCCACGTCCGACATGTCAATCATCCAACGCATCATCCAATCGAACC
CGCTGCTCGAATCGTTCGGGAATGCCGCCACCGCGCGCAACGACAACAGCAGTCGCTTCGGCAAGTTCACCGAGCTCCAGTTCGACGTCCGCGGCCATCT
CATGGGCGCGCGCGCACACACGTACCTTCTTGAGAAGAGTCGCGTGACCCACCAAGCCCCTGGTGAGCGCACGTTTCACATTTTGTACCAAGTGTTGGCC
GAAGCGTCGACGCTCCCGCACTTGCATCTCGACGCATCGCGGCGGTATCGGTACGTCCAGCAAGACCCCGCCGACAAAGTCAAGCTCGAGCACTCGTGGG
CCGACACACAGAACGGACTGACGATCGTCGGCATTGCCGACGCCATGCAAAGCGACTTGCTGCGTGTGCTGGCGGCGATTTTGCACCTTGGCGAGTCGGA
TTTTGAAATGGTCGAGGGGGACGTCGACTCGTCGCAGGTGGCGGACGCGGCCGTGCTCGCGACCGCGGCGGACCTGCTCGGACTGCCGGTGGCCCACCTC
GAGAAGGTGCTGACATTCCGCAGCGTGATTGTCGGGCGCGAAGTCATCTCCAAGCCGATGACCGTCGATCAGGCGCGCGACTGCCGCGACGCCGTGGCCA
AGTCGCTGTACTCGTCCTTGTTTACGTGGCTCGTGGACCAGATCAATGCCGCGATCGGCGTCGGCCACGCATCGCATTTCATCGGGATCCTCGACATCTT
TGGGTTCGAAGCGTTCGTGCACAACTCGTTCGAGCAGCTGTGTATCAACTATGCGAATGAAAAGCTGCAGCAAAAGTTCGTTCAGGATGTGCTCAAGACA
GTGCAAGTCGAGTACGAAGAGGAGGGTATTTCGTGGCACCACGTCACATTTGCCGACAACCAGGACGTGCTCGACCTGATCGAAGGCCGCCTGGGGGTAC
TCAGCCTCCTCAACGAAGAAAGCAGCCTTGCCACCGGCACGGACGCGTCCTTCGCGCACAAATTGTCGGCCGTGATGGACAACCACGCGCGCTTCGAGAC
CCCGCGGCTGCACTCGTCTGCGTTTATCATCTTGCACTATGCCGGCAAAGTGCTGTACGACACGAACGGATTTCTAGATAAGCACCGCGACGCCCTCTTG
CCCGACATCAAAAAAGTACTTGGCGAAAGCTCCGTGCATCTCGTCCGCACCATGTTCCCCACTGACATGACTTCGTGCCACCGATCGCTGCATCGGCAGT
CGTCGTCTGCGACGCATCATCATGCTAAACGCGGCCCTGGCGTCGCCGCCACCCGCGCCGTGACGGTGGGCACTCAGTTTAAGGAATCCCTCGCCAGACT
CATGGACAAAATTTCTCACACAAACGTGCATTATGTGCGGTGCATCAAGCCCAACTCGGTCAA