Description :
From Genome Similarity Track
Location :
Scaffold_2377:1692- 3024
Sequence
1332 bases(100 bases per row)
CGGGGAAGGCAATATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGG
CACCTCAGTTCCGAGAAAAACTGTCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGCTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAAT
CATCATCAAGAAGAACGGGGTGGATATACGTGTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTGATCAAT
GAGCTGTTGGAAGATCTGGATAAGGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATAT
CCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAACGCCCT
CTATGGGTTCACCCGAATACCGGAGCCCGAAACGGGTGGATCCGGGGAAGGCAATACGGAAGTGGATCCATTCGAAGCGGGGGGCTAGGGGATCCTGGAA
CCCCGTCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGGAATCGTGGGATCAGTTGTGCGAAAGGGTGACATCCCTACTGGAGGC
GTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAGGGAAGGATTGGAG
GCGAATTCTAAGGACCTGTCTTCGTTAGCCGATTTGTCCCTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGT
TCATCGAGGATTACGCCCTGTTTGCCGCAGTATTGTATGAATTGAGAGAGGTAGATTTTGCGGCGATGACCACTCCAGCTGTCCAGATTAAAATCCAACA
AGCCCTGGCCCGGGAGATGTCGGATCCACGAAGGGATCCAAGTGGTACGACGACAGAAGAGGACTTAAAACAGGAGCTGGATCTACCCCGGGACCAACGG
AGAGAGGATCCAGTCTGGATAGAATCGACGGATCGGAACGTGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACA
GGATCGCGACCACGCCTTTCCTCCGTCATTTCGATCTGGAACGTCAACCTACGGTGATAGTTTATGCCAGTGACCGGGCAATCTCAGCGGCTCTGTTACA
AGAACATGAGGGGATCTGTCACCCAGTCACCT