Description :
From Genome Similarity Track
Location :
Scaffold_91:169181- 174999
Transcript NameFunction/comments
Physo_140910reverse transcriptase
Physo_140911hypothetical protein

Sequence
5818 bases(100 bases per row)
CGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCCGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCT
TCGACGGCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCCATGGA
GGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGAC
CAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGT
TTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCAC
GAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCTGCCAAGGCAAAGACAGGCATGGTGCGGGAGTCGAAGTCCCCGCAC
TCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGA
TCCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAG
CGACATCCCACTCACGGCTGTGAGCACGCCGAGCGATATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGC
TTGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTACCGAGGCAGGCCAGACGGCCATGG
AGGTGCATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAA
GGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTA
CGAAAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGATCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACT
GGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCGAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAG
CGTAAGCTGTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGTCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTC
AAGGCAGCCGAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTGCTGGACTCGACGCCCT
TTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAA
CTTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACG
GATCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCGCTGGCTTGGAAGCCAAGGCCGAGTGGC
TCACGCCCCGACAACGTGCAAAGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCC
CAACGACGAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAG
ATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCAT
TGCAGAGCCTGCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCTGATGACCGTGGCAACACTGGTGTTGTTGC
CTTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCGTGGACTGTGCCTTCCGA
CACCACGGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGACAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGA
TGTCGACGGCGGACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCTCCGCTC
TTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCATTTACCTGAACGGGTTGCGCCACCCT
CAGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAGGTGGGAGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAG
CCACCTTGCTGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGA
GTACTCTGACCGAAATGGAAGAGGAACCATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCG
GTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCTGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATGACGA
CTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGTATCATGACCCTCTGGCTCTGGCTGCCCCGAAGGAAGCGGTGGGTGGCCCGGTGGACAAGAGCGC
AGCTCCTCGAAGCGCGGCGTCGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTGCATCGGAGCAGCATACGCAGGGGCCC
CGTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGACTGCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGTTCGGCTCGAAGGCCAGCGAGCTG
GTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGC
CGCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCGCCACCAAGACCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGAC
GAATCTCCTCTTGCTGCAGGGCCTCCACCTGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGG
CCCTCCTTGATCGTAATGGGCAGATCCACTACCACGTGGAACGGGTCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGG
TTTCCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCTTTATGGGACGAGAAGCAGCGGCAGCTTCGT
AAGTAGCCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTAGCTCTCGCCTCTTGCTT
CAGCTCATCCATCTTCGAGTGGAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGTGCGCAATCC
TCACGGAGTTCGTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGACATTCGGCT
TGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCAGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAG
TAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGGGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATATGG
CCACGAGGAGCCGAGAGCTTCACCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAG
ACTCGATGGCAGTCGTGGCAGTCGGCTGCCTGGCATACGCACCCGAGCTATCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTT
GGGCTCGTGAACGGCACCCTCATCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCC
TTGGCCTCGGCGGCCTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGG
GCTTGGAGCCCGCGTCGCTCGGCGACTTCTGGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGACTC
GGCGTCCTCCGCCTCCTTCTCTGACGAAGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCCTCGGCAGCGTGCGTGCTG
CCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTAT
GGCCCCGAGGACTCTCCTCCTTGCCTCGCGCGGCGTCAGGAGACTTGCTTCGAGCCCAGGCCTGACGACCACTCTCCGGCATGCTGCTACGAGAGCGCGC
CACCTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCTGTTTCGGAGGT
GCTTTCGCACTGCGCGCACTGCGCTTTGAAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGCTGCTCTGTGAGGCCCG
GGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGATTTTGACTTTACGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGA
TCGAATCTAAGTGGGGGAGGATGTAACGGGGTTACATGGAATAGTGACCCTGTCACTATTCCGGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCC
AAGTGGCCTCAGAGCCAACAGATGCATTTTGTATGACACAAACTATAGGGAACTTAGGATGTGTATGCAGGCCAAATCCTATAAATACATTCAGTCTTAG
GTCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGCGTTTGTATAGTCCTGCTTCCTCTGTTAAGAAGT
GCTGTGTGCCCCATCACA