Description :
From Genome Similarity Track
Location :
Scaffold_269:16916- 20036
Transcript NameFunction/comments
Hyaar_Emoy2813384hypothetical protein

Sequence
3120 bases(100 bases per row)
AGTCTGGCGTGTCATAGAAATTCGGTAGTACCCATGGATTGTGGCTCGAAATGCTGTACATATCGATGAAGTACGGCGTCTGCAGTCCTTCCCAGCCGGA
AAGCGGAGGTTTGGCTGGTACAGATGATTTCGTTGAGGACAACTTGTCTGTTGGTAGTTCCGAAGTAGACGTCCCATTTCCACTGGAGTTAGCAGCGTGA
TGATATCTGCTCCTAGCTGCAGCTTCCTGGACAGTCGCCATGTCCTCATTTTCAGTCGCGTTCACAGAGGTCTCGTTGACAGTCCTATATCCCGCAAGTG
ATGCATTTGCAGCACCAGTCAAGCCCACACTGGCGTTATGGGCCGACTCAATAGCGTACAAAAGCATCTCAAAGGATAAGTGGTCATGTATGCCCCACGA
AAAATGATCGTCCGGTGTATTCTTGTACTTCGGCGTCTCGTGCAACATCTTGCGAATTTTGCGGTCGTCCACAAGCTTATCAAACCCATTCTTCAGCAGA
AATTTTTCCCAATACTCCCACGTCGAGTCGACCGCACTCCAAAAGAGATTAAAGTAGCCGCGCTGCTTCAGAAAGTGTGGCAGACCACGCACGTTTAGCG
TTGTACTGTATTGTTTCAGTGCAGTAGTCTCCGTGCACGACGGCAACATTCCAAATAGCGTTGTCAGGAGCGTTCGCGTAGTTTGCACACACTGGGTGTA
GTGTTTGCTATACAATACGCCGCTTTGTGCAAGTTCATCGAATCGAGGCGTCGCACTTTTACCAGTAGTCGCCTTCTTGGTCGCACCACCGAGCACACCG
ACATCCAGGTGCCTCCAAGATTCCATGTTGAGCACGATAATGTTGGGTTTGACTTCTGCTGCTGCCGATCCAAAACTAGCATTCGTCGTTGCATTCGCAG
CGATTTCATGAGCTATAGTCTCGGAAGCTGTCACATTGAAGTCCAGATCGAAAAAGTTCTCACCTTCATAGCCCGTTGTCTTGCGCCACAGCAACGCACA
ATGATCATCATTTCCCAGGCCGTCCACTTCGTACTTCTCGCTACTACCTAAAGTTGATCGCAATACGCTGCTAGCTGCTGTGCAAATTATCTCCTCACGA
TGGATAGCCGTAGGGCGATAGAAGAAATGCTCAGTTTGTAGCGTAAACATGGCGTTATTCATAAGCTTCATATCCACACCACCCTTCCCATCGATCAGCA
GTGATGCTGACAAAGCAGCGGCTGTCATCAACATACTTGCAAGAATGCATCGGGCCAGCACAGTCAACGGTCCAGATTTAGTAGAGGAATTGTAGCCCAA
AGACAGCGACGAGCTTAATACTGACGCTGTTGCATGGCTACTAACACCTCCACCAGCAATTCCACCTGACAAATGACCATAACTTTGACTGCTGCGTCTT
CGTGCGTAACCCGACTTTCCCGCACGCTGCCAATACGACGCAAATAAGTTAGACGCGTACGAATTTGACGTTTCCAGTGCTGACACGTTCGTTGAAGCCA
TCGAGTCTTTCCGCGTGCTGAGTTGTCGATCAAAACAGCAGCAGAGCACACTCGGTAGTCGCAAGAAATCGGATGCTAACGGTAGTCGGCCCGTATAGAA
TCCATACGTTAATGCAGCAATAAGTGCAAAGTACACTGCCCAGGATCCCACGACTGTCCGCGTCATAGCTTCTTCGTCAGCCATCGACGCAGTGAATTGC
TTCATGTAGTTAAAGAAGATGTTGACAAACGCGCGATTCAACCGCGGGTGCATTGTCACTTGGAGACAAAAGTCTGCGACGCTCGCAATTGTCGCTGCCA
CTAGAATCAACTGCAGTAATAGAACAATCACGACCGCGTGCAGCACGCGCTTCATTCGTGTAATTAGTGCTAGTTGATCGGCTGTAGCAGCGCCTAAACT
CAGCAGCGTTCGATGGTTTGTGACCGCGCCAGAGGCTGCTACCTCCATTCCTTCATCTGCGAAATCATACGCTGTAGCAAATACCGGCATGTAGACTGGC
AAGAACCTCGTGCTTGCACTATAGTCCCTTAGAAAGCCACTATTTGGGAAACTCCTGACGACCGCAGCAGTCGTCTTCGTAGCAACTACAAGTCTATGTG
GCATCAATGCTTCATCCCCATCCAATAATATCTTGACGAAGCAGATGCACGTTGCTGTCTGCAAAAAGATCGCCACGTCCTGCAGCCACCCCACCAGCAG
CCCTTGAATGATCTTGAACATACTAAATCGGTGCACAAAACGGGCAAAATTTAACACGCGTCCAAGCACTGGCAGCCCTAGAAACGCGTACACCAATACA
GCAAGCCACATAGTCTGGTACACTTTCTGAGACGCCAAAAAAACGCTGCGGCCTCGGTACCACCGTTGCGTGCGACCCCAGAGGGACGTATCGGTATCCA
AGCTTGTGGGTTTTATGCCTCCTCGCGTGACGTCGGCCAGCTCTTGCGTGGGCAAGAGGCCCCTATTGCGGCGGTACATTATAGGTATACTTAGAAGAGC
TACTCGTTTGGTCTGAAGTTTTTTTTTAACGTCAGTCGGTCGGTTAGTTGGTCGGTCGGGGTTCGTTACTGTAATTGGGTTTTGTACTTATGTGGATACC
TCGTTTCCTGTGTGTAGCTGCTCTCTTGCTATAAATCGAGTGTAATAGGGACAAGAGAGAGCGTTCTGAACCCGACTGACCGCGTGGTGGAAGGAGGAAA
TGATTGCGTAACTTGTTGTACAAGCAAAGGAATGACCTACTAAGCTACGGATGACGGACTGGCAATAGGCACACAAACTTCTCCCTCTCCCAATAGGTAC
ACAGTAGTAGCACGTATTGTGGTACTTTAGTGGCGCAAAGAAGGGGATACTCCTCACTTTATCTTCCGAGCGGCTGGGCACTATATTTAAGTCCTGGGAA
CATTGGCGACTGGCTAGGAATAATGGACCCGACTGGACGATTTTTGTGTCTCTCGGTGTGCAGAGAGTGTAACGCGTGAATCGAAACCGGATCTCTCGTC
TAACGTGGCAAGAAGCGGCCAGAAAAGAGCCGACTGGGAGGAAAGCGTACCTCGTGCACTTTGTCGGGTACATAGCGCAGCCAGCGTGCAGACGTGTATG
GCTCACTTACACGTACTACT