Description :
From Genome Similarity Track
Location :
contig_6:169151- 171450
Transcript NameFunction/comments
g2076.t1KUF94435.1 DnaJ subfamily B member 4 [Phytophthora nicotianae

Sequence
2299 bases(100 bases per row)
CATGGAGACACCGCCGAGCATCAAGCAGCAGTATGCGAGTCCGCCGCGCGAGGCGCCGGAGCAGCGGCGTAGGCGATTGGCCAACCGGCGCGCGGCCAAG
TACCGGCACTTCCGGTCGCTGGCCCACGCCGCAGACCCGACGGCTGCACTCCAGAGGCAACAGAACACACGCCGGCAGCGAGAACGGCGGGCACAGCTGG
ACGACGAGGCGCGCGACCGCATGCGCGCGCAGAACCGAAGCCGCCAGCAGCTCCGCCGCCAGAGTTTGAGTGCGCGCGCCAAGCAGGAGGACCGCGAGAA
GCAGCGCACACGGCAGCGCGAGCGGCGCCAAACGCTGAACACCGAGGCGCGAGAGGAACTGCGCGCGCGGGAGCGGCTGCGCGTCCGGCGTCGGCGCCGC
CAACTAAAGGCCGCGCTGCCGGTCCCATTGCATGTACAGGAGCGTGAGCGGCTGCCGCATCTGAGGCTGGCGCCGAGCTACCAACGTTGCGCCAGCATCA
GGAGCAGCAGAGACAGAGACTCCCGTTCGGAGGCGGCGTGCAGATCACGCTGCCGCCGCCGCCCATGGAGCGCGTCCGGACGTTCCCGTCGCTACCTCAT
TTGCAGCAGGTGACGAGACCCTCGGCGTCACTGCTGCTTGCGACGCCCCCGCCGTCGTTGTTCCCCATGCCCGGGCCATTAGCGGCGACAAGTACAATAC
CAGGTAGTGCGGCGTCGGGACTGCCTACGGTTGCTAGTGCAGTTGCCGCGGCGGCCACGAGACCGACGCCCATCATGCCGTCCGTGAGTTTGCCGCTGCC
GAACAACGCACTGGCGGCTCTGCCGATGGCACCCCAGCAACCGCCACGGACGCCGATCGTGCTCCCACCAGCGCACCGTTCGCTACCGCCACTGCCGGAT
TTCTTAAACAGCCGCGAAGCCTTAACCCCGCTACTGCCGCCGCTGCGTCTGCAGTTAATACGACACGCGCTTCCCGACCTTCGAGCAGTGCTAACAGAGC
ACTGTTTCCGTATATCACGGATCTACCTGCAACACATACAGAGCCCCAAGACTCGGATACGTTTTTCCAACGATGAGAGAGCTGTCACGTAGTATGCAAG
TGGACGAAGTAGATTGATTTGGGAGAGGTGGCGGGCTAGTATTGCTAGTTTCTTGCACTGCGAGTCAGTCTACCGCAACAAACTATCAAGCTTATTGACG
CTGCCCTTCGCTAGTGGCCGGTGTGGGGCTTGAACGTGCCAAAGCGCCGGAAGGCTTCGTGGGAGTACGCGCCACGGTTTGCCAAGAGGAACATCTCGAG
TTGTGTCTCCGACAGATTGAGCAACTGATAGTACCTCTTGGCATGCTCCAACCGCGAGGCCGACGAACAAGACGAGGGCATCGAAGCCGTCGACGACAAG
GACGCGCCGTCACGCGGGTACGAGTACAGAGTGCCTGTGAGGCCTTGGCGTAAAGCACCGATATTGAGTAGCATCTGCTGGACGCCTCCGCGTGTGAAGG
TGGAGTCGGTCATCTGTGCGAGGTTGCCGATCAATAGGCGCGACAGCAGCGCATCCGCTCCATTGAAGACAAGCGCCATCTTGTCGCTCGCCAAATACGG
CTGCAGCGCGTTCTCGATCGACGAAAGATTGAGATTGAGCGTGAGCACACTATCCTGAGCCATGGTCGATTGGCCTTCTTCCATGTCAAATCGTTGCGAA
ACGAGCTGCGTGAGGTAGTAGCAGCAGTGCAGGCGCACCTCGCGTCGCAAGAAGAGAAGACATTCATCAGCTAGTGCGCTGCACTGCCAACTCGCAGCTT
GAAGGGCCATTGTGAGTGCTGGTGAGGTGGTTGGTGGGGCTGAATTGTTGTTTGACTTCCCTCCCGAGCCACCCGCGACGCGTTGAAGATACAGCGCAAT
GAGATCACACGCGCTGTTGGCGTAACCAAGCATACCGATGCGTGCATTGTCCATAAGGAGACCATTGGGGCCCTGCATCCATGCATCTGGATCATACATC
TCGCGTTCAAGCTCAAGCTCCTGAGCTGCAATCGTCTCTTCCGCGCTTGTCCGAGTAGAATTGGCCCCGCAACTCGCTGATCCTGTCGGTTGCACTTTCG
AATGATGATACGGAATCGGGCTGCCTTGCTTCGCGCGCTGGTAGCCTTCGTACTCGTGAAAAATGGTTGCCAAGTCAGCATACGTGACGTTTTTGGATTG
CAATTGCTGGTGGTTGAGCGTATGCTCGCGAATATCGCGCACAATCACTGCACATTCTTCCAGCCAGCTCACACCGAGGTTTCCAGCACGCTGGCCAGA