Description :
From Genome Similarity Track
Location :
Scaffold_200:16915- 19011
Sequence
2096 bases(100 bases per row)
TACTTATACCTACATCAGCCTTAAATCTACTCTTTTAAGTAGCAAACCGTTCCCATTGAGGCCGGGAACACGTGGACTAACACTCACTTGGGTAGTTAAT
ACCCTTAAGCACTTCCTTTGTGCAAGGTGCTGTGTGACCCCCTCACACTTGGTAGCACTCGTTGTCAATCCAACACCATCGCGGGTAGATTGAACTACCT
GGATCCTCTGTGCGCTCAGCGTTTGACCCAAGATGGACCGAAGCGAGTTTCCTCGCTTGAACGACTTACAGTACGAGTCGGTTCGGAAGATGGGAGGCAT
CTTTGGACAAGATGTCCTTCGCAGCTTGGCGGCGGCGACGCCTGCCGAGCAACAAGAACGCGTGTATCGCGTTTGAGACTTATGAGCGTGGTCTCATCGC
TCACGTCTGCGGGAGCCTGGAGGCCACGATGACCGCTCCCCAGGCAACCAGGCCTACGTCGGCGTGGCTGAAGGTCCCCGCGTTTGAGGGGAAGGAAGGA
GAGAACCTTCACTTCTGGGTCCGTGAGGTGGAGATCGCCATGAAGGCAGGTCTCATCTCGGACGAGCCAGTTCGGGTGGCGTTTGCCCTGTCCAACCTTG
GTGAGCGTGCCAAGCACTGGGCATACACCAGGAAGACGACATCTCCTGGATGTTTTGCATCCTGGGCTCAGCTGTGTGGGCAGCTTCGACCCGCGTTCCT
ACCGGCGAGCAATGAGTTCCGTCAGCGCTCACGCTTTCTCGCGTGCAAGCAAGGTAAACGTGAGCTGCAAGACTACGCGCAAGAGATACGCACGTTGGTG
GCATCTCTGGCAGGGAATCCTCTGCCTGAAGACGTCAAGACAACAGTCTTCATGGATGGCCTGAAGGTCGGTCCTGCTCGCACCCAGCTATTCCGGGTGC
AAGCGACAACTATGGAGGAGGCGATTCAAATCGCCCTCCAAGAAGAGTACAGCCACAAGCAGGCTGGTACTCCTCGGAAAGAGGAACATCGCCATGATGA
GGATGGCGTTCCTCGGAAGGCGGAGCATCGCAGCAATGACGCTGTTGCTCCTGCTGTCACGCAGCCCGTTGATACCGGTGTGTACAGCGAGCCCGAACCC
ATGGACTTTAGCTCAGCCGAGAGCTTGGTCCACTGCTATGGATGCGGCGGACATGGACACTACCAGCGTGTGTGTCCCTCGCCAGCCATCGGGAAGAGGA
CAGCCCGTGGACCCCAAGTCCGGTGGCGCAGGCCACGGCCAGGTGGACGGAGACTCCCCGGTCACCAGTAGAGGCGGTATGCCCTACTGAAGAGCGCTAA
ATCCTTGTGATGGGTGTGCAGGTTGTGCACACCACGGGACTTAGCCCAGAGAGACGTGGTTCTCTCAAACCGGTGAAGGGTAGTGATGGGCTGCTGGTAG
TACACTCAGTGTACGAGGGTACGGTATCCCTTGAACGTTTGATGAGTTCTGGGGCGTTGATACGCCACCGGAACGTCGCTTGGCATAGCGACATCCGACT
GCACTCTATGTCAGAGTGGCGGTCGTGGGCTGGTCCTTGGTGGACTAGCCTTTGGTACGGTGAAGGAAGTACCAATGGTCCTCAACGGACCTGAACGTTT
CGGCTCGATGAACTCACGCCCCGCGGTGTCGCTCGCAGTTTCGCCATGAACAACATGGCTGTGCCGAACATAAGACACAGCCCGGACTTTGGTGTGGCAA
GGCTGAGAAGGGCCTACCAGTCCAGGTCTATGACGGAGCATTGGTGAGTCATGTTCCCACCTCCGTCATGACTGGGGCGTCTGATACAGACCGCCAGGAC
GCAGAAGCGTCACGGAGCTGTCAACGCGCCGACAGCTCTGCGTTCAGCAAGACCATGCTCCGCTGCGGCAATGTCACGGGCGTGGGTCTTTCGCCCGGCT
TGTGGACCTGCTACACCAGCAGCGTCCAACGCCGAAGGTCGTCGCGCCGTACGGGCTTCAACAGTGGCTATGCCTTTAGGCGCTAACCAGGTGGGTAACT
TAGGACCACCCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGCTGAATGCGCTTCCTGTGTGGATAATACAGTACCACACGCAGTTGACCAGACT