Description :
From Genome Similarity Track
Location :
Scaffold_160:16912- 20603
Transcript NameFunction/comments
Phyta_totarag4820hypothetical protein

Sequence
3691 bases(100 bases per row)
ACACCGACTCAGCCACttgatcaagcagcaaatcGATCAGCACAGACTCGGACCCAAGGATGGCACCGACGTCGGACGGGTTGACACTTCCACTACAACA
AATTctgcgaagaagaagcttgaCGACGCGCTGGGACCGAGGTGATGCTATGCGAAGCATTTCTAGCAGACCTCGAAGCATATGCGGGCGCACTAGATAC
GTAATTGCCGGGGACTGCTGACTTTGTGAAAGCATAAACAACAGGACCCCAAACATGTGCGTCTCTACTTCCAGAGGCTCCAAAAGTTCACTGTCCTCAG
ATAAATCGCTTGGAGCATGATGGATATTCACAAATCCAGATTTTCCGCGTGCTACATCGCTTGGATAGTGACGAAGACTTGCTCCTCGCTTTTGAACCGG
AGTAGAAACCGAACGAAGCATTCGCTGAGCACGCGTCAGTCCCTCGGCTTCTTCAGTAAGCTCCTTCCCTTGAATCAGTTCTTtctcaagaacttcaaaT
ACTTTTCGGTGGAACTCTTTTGAGAACCACAATGTCTGAAGAACAGGCTCTTTCAATTCTCTGTTCGTAGCTGCACTCTTCGCAGCATcgcttgcagctt
cagctgttcgagcagcagcgtcttcatctgtgAAACCCACACTTGGAGCGTTTGAGGCTTCTGTGCTCGGCAGTCCACCAACCGCCCCAGGCGAGACCAC
ATTACCTGAACTACCAGACTTCTGAAGCCGCTGCTTTCGCTTCAGTTTTGCAACAGCGGCGACAGATTTAGCTTCTCCCTCTTGCCTCTCGTAAGTTCCA
CATATGCCAGTCGATGCTAAGAAGCGAAACACAACCCAAGCGCATCTTCTCGTTTGTTTTCGAATGATCATCTGCTCATCAGTGCAAGCGTTCCATTGAG
AAATCAGTCTTCTTGTTGTTTCATCCAACGGCTGACTATTTCGTGCAGCAAATTCACCTCGTTCGGTTTGGCATCCACTCAAGTATGCATCATCACTATC
TTGCAACTCTACGTCGCTATCATCGCCATCTATCCGAGATAACTGGCTCCAGTTTTGAATCGCAAGATGCTCATCGTGCTCACAAACCAGTTTCGCAAGC
CGGGCGGACTCGTTAAATTGGGTCGTCAGCCACGACCGAACCTTACGCTGAAAGGATCGAATGCATGCCATGACCCGACTCCATTCATTCGGTGACATAT
TATCCAAAGCATCATTTCCAAAGACTGGAATGCTCGTAGGAACCCAGCGACAGTGCGAAATTGTTGAATTGTACCCCCTTGCCTTGGGACCTTCGGTTGC
AGCTTTTAGGACAGGGGCACAATCATAGCCACAGATACCTTCCCCTTCAGTCAGATGCCACAGCCCGATCATATCTTCAGAAAATACTTGAGACTTTGCT
ACCGATGAGTCACTCGAGCGCCTTACCAGAGGAATACTGCGCTGGAAATCGTGCATAATGTCAAGGCAAGTACGTGATACTCTCCATATTCGAACCTCAG
CGATCGATCCCTTAAATTTGCGCTGTGAAGAGACGTTCGTGAGTGCTACGCCATGTGTGTCGACACCACTCATCCAACAACCGAGTCGCGAAGGTCGGaa
gttcacgctgctgcatacATGTTCAAATTCCATTTTCTCCGATAAAATCCCGTTCACGAATAGCTGGAGACACCTTTTTGTTGCATCGTAAGTGACCGCG
CAATGCGTCCATTCAAAGGTCCTGAACTGGTACGATCTAAATAATCGCTCGCGCGGGAAATTGCCAGGGATCGATAGCTGCAAGTGTCGCCCAATTAATT
CCAGGTATACGCTGCCACTTTGGACGCCATTGTCACATCGTAAGGCTTGACATCCTACCAGTTCAGTTGGGAAAATCCACATCTCCATTGTGAAATCTTT
CACTTCACCCAACGCCGGCATCTCCACGTAACTTATTTCGTCTGGTTTCGGGTTTGTCGATGGTGCCTGAGCACCTCGTGCAGTTGTTGGTGTTATCCTA
GcaccaaacagcagcactttAAAAGTGAGAGCACCAAGCGGAGGGCCAAGCAGCTTTCGTTGAAGTCCAGCCAGAATGTCAGCATAGAGTAGCGAAAGCG
AGGAAGCTGTGTGGCGTGCCGTTAATGGGACTGCATCTTTTGTGCTCTCCAAATCGTTCTTTTTCCACCACTCTGCTGGACACGCATAATGAGGAGCCcg
gcggagaagacgaaTAACATCACGTTTGGTCATGTAGCCACTTCGTAGAAGTCCTTGTTGAACAAATTCCTCCGACAGAGGATGCCAATTTATACTCGAG
TATTCACGTACGGAGCTACGCGACTGAGCATCAGCGGATCCACTGTTGTTGTCAGCAACTGCTTCACGTAGAACGGAACTGATGGAAAATATTTCCTGCA
ATTTGGACAGCATTCCAGTGTCTAGCAAGAATTGGTGATCCCGCGGCTCGAAATCCAAACTCCACGCGCACAGAATAGTTTGTTTTAGTTGCGGATCGGA
CACACTGTAGCCCGAGCTCCCACTGAGCAATTGTGCCAAGTAGGTGTATAGTTCGTAGAAAGCACTTTGGACGTTTTCGATAGTTTGTCGATTGCAACCC
TCGAGTCCCTTCAAATAGTGGTGGCGAACTGTAGCCCGAAATGTCTCTGCCACAACTTGCCCGTCATTCAGTTCTCGTGACTCTTTCTCACTCTCTGTAA
AGCCTCTCATCGCAGGGCGCAGGAAGATGAGAGCATTGTGGATGGCCGAGTCGTAAGACAGCAACGATATtatgctcttcatcgcttgGAGACCGAACAG
TCGAGAATCAGatcgtcgctggcgtcgctCGAGCAGCAATGCGAGCACTTCGGGTGGAGCTCCAATCCCGTCACGAATGTACAACTCACACGCTTTCATC
ATCGCGGTAAAACTGTTCGTGTAGTCGTATTTCTTGCTCGCAAGCAGATCATCGGAGCCTTCATTATCCGTGCTGTCGTCACTTTCAATTGGTTGTGGGG
AAGTACCTGGTGCCATTGCAGACGCAAGCCCTTGAATAGAAGCTCGCCGAGCTCTCCAACGATGTTGAGCACGTAGTACATCCACAATTCCAGACCACTT
CGAACTATCTGCCTCACCTAGCGTTTTCCATCGCTCAAGCATAGGTTGTAACGATGGAGGCGTCTTTTGAGCACTCCATTTTTCCGCTAAGTTGAATAGC
GCCATCTGAGAGTCTCCTTTAAGGCGTTCTGCTTCCTCTGACGGCGGTGCCAGTTTACACAAAAATTCCGCTCGATGAATCATTTGCTTTTCTAGGTCAT
CAAAAGTCTTCGGTACCACCACGCTTTGTTCCAAATTGAGGTTGTCAATTAATCGCTTGGCCACCGCAGTATCATCACGTTGGTCCTTCATTGTCGCTGT
AGATTTTTGATATTCCCGTCCAGGTGAGTCAACTTGCGCGTTCTCATTCAGAGAATATTCGTCTGCTTCTTTCGCCCGATACCCCTGTCTAGCCCTTATC
AACCAGTGACGCAGCATTATGATCCGCTTCCAAACACGAACTAGATCATCGGATGGAGTAAGATTCGTGTGGGCAGCGAAGAAATCTGCCCCGACGACTT
CACCAGCCGTACTTGccccagctcctgcagcgaTTGCTTGCACCTCTTGGAGTACGTGAGATGGTGCATGCATTATCAAAGCAGCAAACAT