Description :
From Genome Similarity Track
Location :
contig_51:169110- 170668
Transcript NameFunction/comments
g8621.t1hypothetical protein

Sequence
1558 bases(100 bases per row)
TACACTCTGCGACAAGATAAATCACCCACCCTCGTTTGAGGGCACAGCTCTGTCAATATTACGCGTTAGCTATTGCTGTTTAGATATGATGCTTCTGTCA
CCAATAGACCAACGTGGTTTGTGCTAACGATTGCAATTTCGCCGCGTGCGGGGGACCTCCAATACAAAATTCCATTTAAGCATAGCGACACATTAGATCA
CCCACTCGAAGCATACAAAAATCAAGTATAAAGAATGACGGTAATTTCAATAGTGCGTCTTATTGCCTTTCTTATCTAAGACTTCGATGCATCTGCGTGG
CATGGTCAATGAGGGACATCAGCAGTGCATGAGGAATGGATTCCCAAGCCGCAAACAATGCAGCCTTCAATTGAGGCACACTATCAAATTGTCTTCCATT
TGCATACACTCGCCTACTCATAATGGACCACAAATTCTCAATAGGATTGAGAATCTGGGGATTTTGATGGCCAGTCGAGCAAGCGAATATCTTCTCAGAG
AAAAACTCCTTGGTGCGCTTTGATGCGTGGATGCTTGCATTGTCTTGCTGGAAGATAAAGTCGATACCGTAGTTTAGATGAGCAAAGGGGAGGAGATACT
CGGAGACAGTGAATCCGAGTTCTGCCTCCCCATAAGAATCACTACCACGCGAGCTGAAGCCAGCCCAAACCATGACAGATCCCCACCAGCCTGGCGCCTC
TTGGTCTGGCGGGGTGGCTTGCGCAGGTCTCGTCATAGTGCTGGAAGCCATCGGGTCCATCCAGGTTCCACTTCTTCTCATCAGAGAAGTAATGGAGTAC
AGATGACCCCGGTGTCCTTGCACAGTAGCATGGCGCTGGCCCACGCTTTGCGTTTCAGCATGTCCTCGGGCTTGAGGGGGAGCGTGTTCACCATCTTGGT
GTACATCTACCAGTCCACCCTTGCTAGGGTGAGCTGGATGGTGCGCACTGAAACGGTGAGCTGGAGCTCCGTCTTGAGCTGGGCAGCCTACAACATGCCC
TTGGCAGCAGCGCGGATGAGACGACGGGTCTCGCGGTCAGAGAGTGCCGGGGCAGGCCCAGGACGCTTGGCTTCTTGGTGTGACGCGTCTGATGGTGTAT
GTGCAGCGCCCTGTGCTCTTCACAACAGCACGGGCGCTCAGCCCAGCTTCTTGTAGCCCTTGGATACTGCCCTTTTCGCGCTCGGTCACCCAGCTTCTTC
TTGCTAGCCTTCTTCATCTTTGGAAAATGATCCGCTCCACTGCACCCAGAGTAGCGATCTCGCAGCGCCAGTCGCTCAAAATGCCAGTTGCACGCCACTC
ATTTTCCAAAATTACCGTCATTCTTGTATACTTGATTTTTGTATGCTTCGAGTGGGTGATCTAATGTGTCGCTATGCTTAAATGGAATTTTGTATTGGAG
GTCCCCGCACGCGGCGAAATTGCAATCGTTAGCACAAACCACGTTGGTCTATTGGTGACAGAAGCATCATATCTAAACAGCAATAGCTAACTCGTAATAT
TGACAGAGCCGTGCCCTCAAACGAGGGTGGGTGATTTATCTTGTCGCGGAGTGTACTA