Description :
From Genome Similarity Track
Location :
scaffold_6:169080- 171383
Transcript NameFunction/comments
g1910.t1hypothetical protein
g1911.t1hypothetical protein

Sequence
2303 bases(100 bases per row)
CATGGAGACACCGCCGAGCATCAAGCAGCAGTATGCGAGTCCGCCGCGCGAGGCGCCGGAGCAGCGGCGTAGGCGATTGGCCAACCGGCGCGCGGCCAAG
TACCGGCACTTCCGGTCGCTGGCCCACGCCGCAGACCCGACGGCTGCACTCCAGAGGCAACAGAACACACGCCGGCAGCGAGAACGGCGGGCACAGCTGG
ACGACGAGGCGCGCGACCGCATGCGCGCGCAGAACCGAAGCCGCCAGCAGCTCCGCCGCCAGAGTTTGAGTGCGCGCGCCAAGCAGGAGGACCGCGAGAA
GCAGCGCACACGGCAGCGCGAGCGGCGCCAAACGCTGAACGCCGAGGCGCGAGAGGAGCTGCGCGCGCGGGAGCGGCTGCGCGTCCGGCGTCGGCGCCGC
CAACTAAAGGCCGCGCTGCCGGCCCCATTGCATGTACAGGAGCGCGAGCGGCTGCCGCATCTGAGGCTGGCGCCCGAGCTACCAACGTTGCGCCAGCATC
AGGAGCAGCAGAGACAGAGACTCCCGTTCGGAGGCGGCGTGCAGATCACGCTGCCGCCGCCGCCCATGGAGCGCGTCCGGACGTTCCCGTCGCTACCTCA
TTTGCAGCAGGTGACGAGACCCTCGGCGTCACTGCTGCTTGCGACGCCCCCGCCGTCGTTGTTCCCCATGCCCGGGCCATTAGCGGCGACAAGTACAATA
CCAGGTAGTGCGGCGTCGGGACTGCCTACGGTTGCTAGTGCAGTTGCCGCGGCGGCCACGAGACCGACGCCCATCATGCCGTCCGTGAGTTTGCCGCTGC
CGAACAACGCACTGGCGGCTCTGCCGATGGCACCCCAGCAACCGCCACGGACGCCGATCGTGCTCCCACCAGCGCACCGTTCGCTACCGCCACTGCCGGA
TTTCTTAAACAGCCGCGAAGCCTTCAACCCCGCTACTGCCGCCGCTGCGTCTGCAGTTAATACGACACGCGCTTCCCGACCTTCGAGCAGTGCTAACAGA
GCACTGTTTCCGTATATCACGGATCTACCTGCAACACATACAGAGCCCCAAGACTCGGATACGTTTTTCCAACGATGAGAGAGCTGTCACGTAGTATGCA
AGTGGACGAAGTAGATTGATTTGGGAGAGGTGGCGGGCTAGTATTGCTAGTTTCTTGCACTGCGAGTCAGTCTACCGCAACAAACTATCAAGCTTATTGA
CGCTGCCCTTCGCTAGTGGCCGGTGTGGGGCTTGAACGTGCCAAAGCGCCCGGAAGGCTTCGTGGGAGTACGCGCCACGGTTTGCCAAGAGGAACATCTC
GAGTTGTGTCTCCGACAGATTGAGCAACTGATAGTACCTCTTGGCATGCTCCAACCGCGAGGCCGACGAACAAGACGAGGGCATCGAAGCCGTCGACGAC
AAGGACGCGCCGTCACGCGGGTACGAGTACAGAGTGCCTGTGAGGCCTTGGCGTAAAGCACCGATATTGAGTAGCATCTGCTGGACGCCTCCGCGTGTGA
AGGTGGAGTCGGTCATCTGTGCGAGGTTGCCGATCAATAGGCGCGACAGCAGCGCATCCGCTCCATTGAAGACAAGCGCCATCTTGTCGCTCGCCAAATA
CGGCTGCAGCGCGTTCTCGATCGACGAAAGATTGAGATTGAGCGTGAGCACACTATCCTGAGCCATGGTCGATTGGCCTTCTTCCATGTCAAATCGTTGC
GAAACGAGCTGCGTGAGGTAGTAGCAGCAGTGCAGGCGCACCTCGCGTCGCAAGAAGAGAAGACATTCATCAGCTAGTGCGCTGCACTGCCAACTCGCAG
CTTGAAGGGCCATTGTGAGTGCTGGTGAGGTGGTTGGTGGGGCTGAATTGTTGTTTGACTTCCCTCCCGAGCCACCCGCGACGCGTTGAAGATACAGCGC
AATGAGATCACACGCGCTGTTGGCGTAACCAAGCATACCGATGCGTGCATTGTCCATAAGGAGACCATTGGGGCCCTGCATCCATGCATCTGGATCATAC
ATCTCGCGTTCAAGCTCAAGCTCCTGAGCTGCAATCGTCTCTTCCGCGCTTGTCCGAGTAGAATTGGCCCCGCAACTCGCTGATCCTGTCGGTTGCACTT
TCGAATGATGATACGGAATCGGGCTGCCTTGCTTCGCGCGCTGGTAGCCTTCGTACTCGTGAAAAATGGTTGCCAAGTCAGCATACGTGACGTTTTTGGA
TTGCAATTGCTGGTGGTTGAGCGTATGCTCGCGAATATCGCGCACAATCACTGCACATTCTTCCAGCCAGCTCAACACCGAGGTTTCCAGCACGCTGGCC
AGA