Description :
From Genome Similarity Track
Location :
contig_9:16906- 21969
Transcript NameFunction/comments
g2571.t1hypothetical protein

Sequence
5063 bases(100 bases per row)
ATTCACACGAAGTCGCTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGAC
CAACGCCTTGAATCTCGATCTCGACGTAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGC
ACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCAT
CGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCG
CAGGCGTGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCA
CTGATGTTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCTGTGGACACATATTCTCGAGCTGGCCCAGTCA
TGCGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATT
GTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATAGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTG
TCGATGAGCATGTCGCGTGGAATCTTAATGTAGTCATTTCCCAGATCGTTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACG
CAGCCATTTCTGCAGCACTATCGGAGGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTATGGAAAAGTGGCCACAGTTCGGATGACTT
CAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTT
CTGCCTCGTTATCCAAAACGTCACGAAGCGTTCTGTCCACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCTCGTCCCAAACTATCAAACTTGCTTT
CCTCATCAATTCCGTGACCTGGGATCGCTTGTTGATGTTGCAAGTAGATTCGCCGTCTATCTTCAAGGGATTTTGAAGGTAGAATGCGCTGTCCGACCTC
CCATAAGCAGCAGAGAAGCAATCCCACTGGAAGCGACCGCGATTGCAATTTTTCCGGATAGACGAACCTTGGCCAGTATGTTCCGAAGCAGTGTCGACTT
CCCGGTACCGCCTGGTCCATCAACGAAGAATAGCTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTCAAGCGCTGCTCCTCG
TTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCA
CCAGGCGAGGGAACTCGCTCAGCCGAGGGAGATCAAAGTCTTGGACGGAGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACGT
CACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGGTTCCTGTACGCATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCGAACATCC
GTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTGT
CGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGCG
ATGGCATAATAGCAGGCGTAAATAGAAGCGCTCCATATCACGCGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCAG
CACTTCGTGTTTCCCATCCAGCGGAATTCCTTGGGTATATCCTGGTACAGCATTGTCTTCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCGA
AGAAGCGGGTCAACATGGTGTGATTCCCACGACCAAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCGACGTGAACGGT
AAGCTGAGTGACTGCGTGTGTCTTTCCTTGGATCAAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCAGA
ATCTCGTTTGGCTCTTGCCGAGGGAGCTCTCCACCCGCGCGAACTGCCTCGACAGTTAGCACAGCTTTATCGGACCCTTTGTAGACGTACTTGTATAGAT
ATTTCACAGCTGAAATATCCGTGCACACCTCGACGTTGATGTGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAGT
GGCGTTGTCGTACTCCCTGCCCTTCCATACCAGGACGCCTTCAGCTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCCTTGTCGCCTCT
GCAAAAGGTTTCGGATATCCTTTCGTACACTTCCCGTCCTTCATGCAAGCGCATGACGGGTTTGCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGA
TTGTCTCGAATAGCTGCGGGAACTTTTCTCTGTCAGGAAGCTCTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAA
AATGATCAAGATGTGCGCGTGAGGGAGCCCTCTCTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTA
AGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCGACTATCTCTTCCC
ATGTAGGGCTGCAGGTCGTTGTCATGAACACATCAGGCTTGCCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATCGCTCGAGGACT
GCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTTGGCTAAGAAAATGGGTATCACCACCACGGCCTCGATCAGGGTGGACCAACGTACCATCG
CCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTGCTTCCAGCTGAATTGTACCTTCGTTAAGCAGTGCGTCCTGAAGCCCTCGGTACTGATCGGCGCGAA
TTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCGCATTTAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAAG
AGCAGACTGATCTCCCACTTTTTGGTGCAACCGGAAGGCGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCCGTTCGCGTATGTG
TCCGTGTAGGTCCAACCCAGCTCCCCATACGGAAGCAGAAGAGGATACTGAAGAGGATCATACTCCGGGCGCGTCTCGAACAGTCGCAGAAGCCTGTGAT
CCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGGTTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGG
ATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGTCGCTCGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCAAAT
GGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGCCACAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCG
GGTCCACAATATAGATCTGCGCGAACTTAGGGTCCGTGCGCTCTCCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACC
CTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTGCATCCTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTG
AACGCAAAAGCTTGGTTATACGCTCGTATGTGCTGTCGAAACGCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGAC
GAACCTTGTCTTCCAGACAACAGCTCATTTTTGATTCGCCAGGCCACTTCCAAGCGCCACAATGTTCACAAACAGTGGTGGGAGGAAGCCGATGGCGCCC
ATTCACAACGTCTGGACCCTGGACGTAGGCCACGTCAAAATCGTCGTGGTTTGCCAACGCCTCTCCACGTCGAGCCGATCTACGCCGAAATCGCTCTCTC
TCGCGTTGCTCCAGTGCTTCTTCCTCAGTCTGTTCTCTGCGGCGTTCCGCATGTTGCTCTTGGTTTACCTTGCGTTCTTCGGCGCGTTCCTCCTGCGTAA
GCTGTGATCTGCGCTCCGCGTGTTGCTCTTGGTTTACCCTTCGCGCTTCAGCACGCTGGTCCTGCGTAAGCTGTGATCGGCGCTCCGCGTGTTGCTCTTG
ATTTACCAACCGTTCTTCGGTACGCTCCTCCTGCGTGAGCTGAACGGCGCCGGCGTCCGCGTGTTGCTCACGATCTGTTCTGCGCTCTCAGTGCGATCCT
GTACACTCCTGTGAAGCGCGCGAGAAGCACTGTTGTTCACGCTCCGCGGCGTGGACCTCTTCGTTCAGATTATGCCGACGTTCCTGCTGTGCGATCCGGT
TTCGCTCTCGTACGTCCTGAAGCTGCTCGGCACGGAGCTGGGCTCGCCGGGCTAGCTTTCGCTCCGCGTCACGCCGCCGCGCACTCTCCCGCTGAGAGTC
GGTCATGTTACTTCGTCTGGAACGCGCTCGCTGCGCCTCCCTCATCCGACGTGGATTTGCTTG