Description :
From Genome Similarity Track
Location :
Scaffold_254:16904- 17907
Transcript NameFunction/comments
g15396.t1POM66404.1 Aspartic protease, partial [Phytophthora palmivora var. palmivora

Sequence
1003 bases(100 bases per row)
GCGTTCAGGATCCTGAGTCTTGTCCCGTTCAGCACTTGGAACGTTCAGGTTCAAAAACTGCAACACTTCTTGGTCAACCAAAGCTTCCTCTTCTGGAGGC
AGGCGCACAAAACCCCACAAGCAATTGTTAATCACAGCTTGATACACTAGAGGTGTATTCTTGAGTCCGAAGGGCATTCGTATCCATTGAAAGTGTCCAA
AAGGGCAAATGAACGCTGAGATCAATTTCGCGCGCTCAGTTATGAGTACAGCCCAGAAACCACTAGCCATGTCGAGACTCATAAACCACATTGCAGATTC
AAAACCAATCAACAAATCATCGATCAGTGGCAGAGGGTATCGCGACAGCTTGATGAATTCGTTCTCCAGGCGATAATCAATACACATCCTGATGTCCACT
CCATTTTTCTTGAGAACAATCACGATTGGCGAAGCCCAGTCTGACTCGGAATGCTCAATCAGACCCGTTTCAAGGAGTTTCTTGAGCAACTCGTACACCT
TGATCGACAGATGTGGCGCAACTTGACGTGCACGTTGAGACACTGGGCGTGCATCCCCTACATCCAGATCACACACAACACCTCGAGCTGGAGCTGGAGC
CGCATTTCCGTCTCCCAGAAAGATCTTCCGATGTCGTTTCAGGATTTCCCTCATCTTCATTTCCATCTCTGGAGTCGTGACTCCTAAGACACCGACATCC
GCATCTTCGATCTTGCACTCAGGGCTCAAATCTTGGACCTCAGGTAACGTAATCAAGTGTTCACGTAGCTGAGCCATAGCCTCACTACCTTCCCGGATAT
AGGCAGGTAGTTCCAGATCCAATTCTTCAGCTGGCACACGCATACACCTCGCATACTCCTCTTGGAGTTTCTGCACAGGCATACTCGCAAATCCTTGAGC
TGAGAAACCTTGAAACTCATCTTCAGACTTGTACTCTCCCAGGCTCCCATTTTGAGTGATACCTTCAGAGAGTGTATTTTCAGAAAGTGAAGGTTGTCCA
GTG