Description :
From Genome Similarity Track
Location :
Scaffold_96:16900- 19644
Transcript NameFunction/comments
Phypl_g3002hypothetical protein

Sequence
2744 bases(100 bases per row)
TGTTCTGGTAGCACACATTCGTCAGATTCTGCTTCATGTTCACCATACCCGCGTAGTAAGGCTGCAGCTCATCCGGCTTCTTCACCGGGTCTGTGGGTGC
AAGCCCACAAAACTCAGACGCATACGGCGACGCAAGGCACTTCCAGTCGCCCGACCCGTCACCTCGATACCATTTTCCGTCAAAACGGGATGCTGTCTTG
TCCCAGTAAAGCGTGCATGCATTGGACTGTGACTGGATCGACTTCTTAAATCTCCCATCAAGCTTCCAGGCCCCATCCTCCGTCAGTCTCGCAAGTCCAC
TGAGTTTTCCATCCTTCTCTAGGTATGTCCCGCGAACATATTCGCCCACAAAACTCTTGTCAAGAGCAAGATGCATCGTACCTCCAGTAGTTTCCCACAC
CGAGTCGTTCATGCTGCCAACTTCCAGCAAGTGACTGAAAGCTAGAGCCGCTGTACGTTTGTACTCATCCAGATAATTGACGTTCTGCAACTTTGACGCA
TGCAGATCCACGGCAGGCTCAAGGGTTACTACAGGTTGATCACCTCCATCCATGTCCATACTCATCGGAGAAGATGCAGACGTAGCGGCAACTTTAGGTG
CAGGCAAAGCCATCACAACTTCGGAGGGCTCAACGGCAGCGGCAATAGGAATCTCCCGCGCAGACCCGCACATGTGGCACGATGTGTCCGATGCCTGGTT
TTCCATCGTGCACGCAGCACAAGCCCAAGGACCAATAGGTTCTACAGCCATCGGGTGATCCTGTTTTGCGGCATCCTCCGCTGCGTAGTAAAGGGTGGCG
AGTCCGTTATCAGTTTTGCTCTCTTGGCTAGACCCGACAACGTCAGGTTCCGCTTGTTTTGCTCGCGGGGTATCACACATTGAGCATTTCGTAGCAGTCG
CGTTATTAAGCATTGTGCATGCTTCACAGGACCAATCCACAGCAGGCTTAGGTTGTTCGACCACCGCCAAGGCTGTGCAGGTAGACTCTGGTGCCGTAGA
ACTGGCTCCAGCATTAAGCTCAGGTGCGTTGTTACCGCATACGCTGCATTGATTGAGATCGATGCTATTGACCACGGTGCACTTGTTGCAGCCCCATAGC
GACCCATTCACTGGGTGGCTGAGTAATGGGAAATCGGAGACTTGGACAGGACTATTGCAGCGACAGAGACCGTTACCTCGAACATGACACGAGCAAGCTG
TCGTAATCACACCTAGCACAACCAGCTCGTGACCTTCGTGGCAAATGACAGCACATACCCGACAAATGCTGCTTCCATGCACCAAACTGCACGTCTGACA
CCCATACGCTTCTTGAGCAATAGCACTACCATCAGTGCTCATCCGGGTACATGTAATagtcttcttctcgccgttATTTTCACCATCGCCACCCGAtcct
tctgcttgaagaGCAGCATACACGTTTCCCAGAACTGAGTTTGCCACTTCCTTGGGCAAATTAGCACTGAGCGATTCGAACGCCCACTTCATGAGCCAAG
TTGGGGTTTGCTGGCCAGATGAATCCTTGCCCGTAGGGAAAATTAAACCAGTTCGCACCGCACTACCTGCCTCCATACGAAGAGCGAATTCCAGATCCAC
TGCCACTTGAAACACCACACCGACGCCGCCAATTGCAACTGATAGAACACGTCCAGGCAGTTCGTATTTGATCTGAATGTCGGACAGGGAAGTGGAAGGG
CCCCCAGCAACCCGAAATACGCGAGATAGAGGATTCTCCTGCGTCTTCGACCAAATGTACAAACCCAACTCGTACATCAAAATCCCCGGGGCTACAACAT
CCGCGCTTACCTTAATAAGCATTGCAGAGCCATCGAAATGCCGAAGCGATGGGTCCGCTACATCGTCACCTGTCACCTGACCGTTTGATATTTTCGCTGC
TTCTGACAACAAGGGAACAAGATCCCAGAAAGAGGTTTCGCACATCGCGAACACAACAGTTTTCCGTGAAGACTGTGCTGCACCTGCAACAGGGGGTCCA
ATAGACAGCATCGATTGAAAGCCATTCGCAATCGAAACAGCATTCTGACGCCACAACGCTGCGCCTGAGTCCCCGCAGTCCACTTTTAGGCCGCTAACTC
CTTCGCTTGACTCATCCGATAGAGAAAAGTTGCCACTACCGAAAAAATCACTTCCGAGAGAGACAGCAAACGTATTCTTCAGTGGAATAGACTCTGCAGG
GGTTGCGGGGGCGAAATTACTAATCGACGAGATCGCTGTCTCATGGATCGCATCGGGAGATTGATATCCTTCGACGACGCAAGCATGATTTTGCTGCTTC
GATAGATCCATCAATAACCGCTCTGAATCACCGACTAAGGGGTAATATCCCACAAggtgcgcttcttggcctgtTAGAGCATACGAAATGCTCCAGTTCT
CTCCAAGATTGGAGAGCAGCGTCGACCAAATGCGCAGATCTAGCATCTGTCCATAAAAGCAACGTGGAATATGTCTCTTTTCGTTGGGATCGCAGCTTTC
AAAGCTACCCCCGATAGAGAAGAGTGGTACGCCCGGTGCAGCGGGGCCTGCCTCATCATGCACGCTCGATCTCGCAATTTCACCTGCAACAGAGCCGTCA
ATCAACAATACCACTCTGTCTTGACCAAACGAAAGTGTCACGTGGCAGAACACCCCAAACTGCACTGCATCACGAGAGGTTACGATGTAACGTCCTCCGG
CAATCCGCCACACCAAATGTCCAGCGCTGGTCAACGAGAGTTCG