Description :
From Genome Similarity Track
Location :
Scaffold_157:16900- 19477
Transcript NameFunction/comments
g10580.t1hypothetical protein

Sequence
2577 bases(100 bases per row)
CTGCTTCCTTCAGGAGACTCTTGTTCCTGAACGCCAGTCGCTTCACAAACTCAGTCTGGGAGCTTCTCGGTACTAAGGTTTTCAGAGCTCCGCGAGTTCG
CTGCAGCGCCACGAACACGATTGAACTGGTCAGCGTTGGGTGTGAGGATGGCGGCATGAACGGAGGAATGGCCGCAGTAACACGATCTTCTCCGAGACGG
AGAGCTTCTTGAAGTGCTGCGACAACAGTTGACCTCACCTCCTGACGAGTCTTCGAAGTGATCAGCATCTGGAACGAAGCACGGGCGGCGGTTGCAGCGT
CTTCATCTTGTGTGGCTGTCCGTCCAATGGAGAGCAGCCCGCTCTCGGACGCACATCGATCGACCAGCACATCAGCTCGTGGAGTTACAAGTTGGGCCAT
GACGTGCTCACACACGTCTGTCGTCACGTTTCCCACAACAAATTCCACTACCGCCTTCAGCTTCGGATGCACCTTGAAAACCGCCTCGGAAAGCTTGTCG
TTTTCTTCCTGGAGCGGCGATAAAGTGCCGGGGAACGCCGTTGCCGGTGACTTCACTCCGGAAGTGGCTGAGTACCCATCGTTGTCATGCTTTGAAGTGA
AAGACGAGATACCACCGTTCTGGTCATCCTGGATCACCACCTGCAAGGGTCGGAGTTTGCGGATGGGTGTGACCAGCTGGCCTTTAGTTATTCGTCCGGT
GCCAGTCGAGAGTTTCCTGCGTGGTAATGGCTGCGCACGAGTCTGAATGAACCCACGCAAGTCTTCCAGCTCGCTCACGCAGCTCTGGACAAACACTTGG
CTGTACAGGAATGGCAGGTGGTCTTCTCCTTCTCCATCCTCTGACGAGACTCCACCCTCCTTTGTGAGCGCCAAACGCACTTTAGACGGCGGAAGGAGTT
CTTCAGACAGATAGTCGCCGTTATGTATGAAGCCAGCGTCCAGCTTCATTACGTGGAAGATGCGCTCGATTTGCATCGCAATGTAGAGTCCTGTCTCGCC
CAGGGAGTTCAATCGCGGCGACCGATACAGGAGCTGCAGCAACACCACAAGTTGCTTGAAGTAGGTCGTTCCTGAAGACAGTTTATCCAGCGAAAGCATC
GTCAGATAGTCACACAGCCATGGAATGCACTTGGAGATGGATGCCTGGAGGATGCTGTTCTCCAGCAACTTCTTAACGTCGAGACTGGAGTCGCGCGCCA
CCTCTAGTGTGCTGATTCCTTCACGCTCGACAGCCTTGAACGCAGCATTTTGCTCAGATAGCTGGCGAATCGAAGACGTGACTTCCCATTGCGGCGAGAA
GCGCAGATATCCGAGGAATTTTGCCATCACCTTGAGTCTTAACACCAGTTCTGTGAAGTTGTTCCGAGCATCAGCAGAGGGGGAGGTGTTTTCTCGAATG
GCGTAGAATTGCCGCTCTAACTGGTGTTTGACAAGCTCGGAGAACTCGTAGCTATCACAACTGTGCAGGAAGTGAAAGAAGAAGAGCTGGTTGTCCGTAA
AAAAACTCTTCATCCGATCAAGCGTTGCCGTGAGCTTTTTGGTTGCGTCGTCTTCGTTGGTGGTAACTCTCGTGTCCTGCCGGGGTTTCCATGGCGAATT
GTTGTTTCCCTTGGCGCCAGTCCTGTTGTTGCTATTGCCTGAGCCGTTCGAGCCGGCGTTGTCACTACTGGTACGCAGATGCGGCTGCGGTGACTTATTC
AAAGGCTTTTGGTTTGAAAAGCGCCGATGCAGCTTGCGCAAACGGTCCGGGTTCTTCACCACGAGTTTATCCTCCATGATCTTCAGCACAAGTTCCTTAT
CGCTTTCACCGAAGGGGTTGGAACCCACTTGCAGTAATTCCTGGACGAAGAATTTGGCGAACCACCACCTGTTCTCAGGAAAGACCTCAGCTAGCAGCTC
CCGCGCAGACGCAATAGCTGCTGCTGCCACACCTGCATTCTCGATGCCAACGAGACTGTGCTGCTTCTGCTGGAATTGACGCAGTAAGCTGAGAAAGCCG
TCCCGGACCTTCTCGCGGTTTGTGTACAAGAGGGATTCCGCCGGCGTCCGGTAGTGCAGGCGCGAGTCGGTCTCTTCGTTGAAAGGGAGTGCGAAGTCTC
GCACGGCACTTGCTTTCATCTCAACTGGCAGCTGACAGCCGACCCGAGCACTTTCAGCCACGCGGAGCTCCTCGCGCTGGCGAGACACTTGGTCAAGTCG
CTCCAACATGGACGAGCAGATGCCCTCGGCGTCGTGCAGGCTGTGCTCGACTAACTTGAGCAGGTCCGAGCCAAGATGTGTCAGCACCGGCTCAATCTCA
TGAAACACGATCTCTGCGAAGTCGAGACAGTGGTCACGCCAGCAAAACTCCGACGGAGCTTCGCAGTTGCTACCACCATCACTCCCCGGCTGCTCCTCAT
TGCTGCTGCAAGCCGTGCAATTGGCCCGATACAGCAGACTAATGAGCACCTGCAGCTCGGCGCACGTACTGCTCACAAACCGCTCTCTGATCAAAAACCC
GTACAGCCTCGCCGCTTGTCGGTTCACCTTGAAGTCCGACGACGAAGCTCCCTTCTTCACATTAATTCTCTTCTTGG