Description :
From Genome Similarity Track
Location :
Scaffold_2:1690- 4639
Sequence
2949 bases(100 bases per row)
TGAGGGAGCAGCGAGATGCTGCTTCGTTTACCACGGTGTCGTCGGGGACGACACCGCGCGCGCAATCGCTGAAGCTCAGCGTGAGCAATTACGTTGGAAG
AGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCCATTGCGGCTCGACGCATCGTCGACCCGTTGTCGAAGGTCGCGTTCGCCATGTCA
TGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGGCGCCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCACGGAAGAGCTCAGACAAG
CGTTTGAGCCCCCGCAAAAAGAGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCACCAGGGCAAACATGATGTCCATGCTTACGCTCAGAGAGCACGGTA
CTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGACTCAGAGATGGGCCTGTGAAGACCTATCTCTTC
CGTGAGTACCCGAGTACTCTCGAAGCTGCAATTCCTCTTGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGACCAC
AGCCACGTCCGGTAGTAAGGACGGCAACTGCTGGATCCCAGCAGTCGCAGGGAAACAATGTGCGATGCAACCGTTGCGGTAGAGTCGGTTACTTTGCTCG
GGAGTGCACAGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTTGCAACCAAACAAAAAAACGCTGGACGCCGGTAGGGGCGGGG
CGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCAGCGAGGTTCATTCTCACTGCAAGAACCAAGATG
ACAAGCCTGACCTTGTCATCCTGAACGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACT
GCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGCTAGAAGTGGGACTGGCGACGGGCGCCGTCGTGAAGACCGAGAAGCAC
CCAAGGGGCGCGGGTGAAGCAGGCAAGTCACACGCCTCAGCCAAGGAGGCTGACGCGGATCTGATTGGATCAGATCTGACCAATAATAAGAGCTAAGGTG
ACAGTACACCGTCGACTCCGGGAGTCCATGGCTTGGATGAATTGGGTTCGTCGGCTCGGGGAGCCGACGAACCCTCCGTAATGGGGGTCTCCGCTAATGG
TAGGCGTCGAGGTATTAACGTCGCATCGGTTCCGGGAACCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAAAACTTGCATGCTGT
CGTGCAGCCGGGCTGCACGACGAAGCGCCAGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCGGTACTGAAGAAGAACACC
AGTCCACGGCTGGGCCTGGACGGGGTCAAGAACCAAGCGGAGCCGGGCTCCACAAAACAAGAAGACGGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCC
TGGGGCCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCAGAGAAGCCGGGCGTCGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGTTCC
GGTACAGGGAGATGACCCTCGCTAACCCTCCGACACAAGCATCGGAGTTTACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGA
AGGACGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGAGCACGACTGAGAGT
GAGGACACTCTCAGTGCGAAGACTAAGAAGGAGCGTTTTGAGGAGCAGAGCTGGGACTCGCTGAAGTCGAGTCCCTTCTACGAGATTCTACGGGAGCACG
CGGACGTGCTTCCGGAAGAGATCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCT
GCAGTAGCCACTGCCGCGAGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAATGCGGGAATCGAAGTCCCCACACAGT
GCTCCGACGTTCTGGGTCAAGAAGCCACAGGGCGGTTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCAACGATACCGGCGCAGACGCCGATTC
CTCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCATGATCTGCGCGATGGATTCTATCAGATCCTCATGCGTGAGAGCGA
TATCCCTCTCGCGGCTGTGAGCACGCCGAGCGGCATACTCTGGGAGTGGCTGGTGATGCCGCAGGGGCTGAAGAACGCCCCTCCGACCTTCAACAGGTGC
GTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACAGGATGAGTGATGTTGAGA
TGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGTGAGCGAGATACCCGT
GCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCTGACGCCGTCGAACGTCAAGGAACTGCGG
CAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGG
TTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGTAGATT