Description :
From Genome Similarity Track
Location :
Scaffold_350:169- 5125
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_350-snap-gene-0.17Ubiquitin carboxyl-terminal hydrolase and/or F-box protein

Sequence
4956 bases(100 bases per row)
CGTCCAGACGGCCATGGCGCCGTCCCCGACGCGATCGTCCTCGTCCTCGTCCTCGCCCGAGTCGCCCGCGTTCCACCACCGTAGCCTGCACCACCACACG
CCCATCACAAGCGGAGCGAGCTACCACCTGGACTCGGCGGGCCGCACGGGGCCGACGACGTCCTCGTCCNNNNNNNNNNACATTGTGCGCGTCGAGATCC
CCAAGTGGAAGTCGCGGCTGCCGGACCACCGCGGGGCCGTCCGCGGGGCCTCAGCCCTCGCGGCGGCGCTGGCGTCCCCCGGTCCGCCGCAACGAGGATC
GTCGTTCGGCAGCAAGAAGAGCAAGAAGAACTCGACCGCGGCCTCCTCTAATAAACACAAGAACCACGCGGCCAAGCCCGAGACACCCGGCCACAGCGGC
TCGCTNNNNNNNNNNNNNNNNTCTCGGCCTTCGACGGCATGAGCGGGCTCAGCGGCCGCGGCGGCGGCGGCAAGCGCTTCACGGCCTTCCAGGTCTACGT
GCACTACCAGTCCGGGGCCGTGCGGCTCAGCGAGAAGCGCTACTCGCACTTCCGAGAGCTCCACAAGACGCTGCGCGCCAAGTACGCGACCGTCGGCAAG
CTCTACTTCCCGCCCAAGAAGTTCTTCATGTCCAACTCGCTCCACGTCATCGAGCAGCGCCGCGAGGGCATTGAGGCGTACATGAACGCCGTGCTCTCGC
TGCGGCCGCGGCCGCTCGAGGTCGTGCACTTCCTGGCCGGCGGCCGCAGCCTCGAGGACGAGAACGAGGACGGCGACGTCCCGGACGACCTCGTGGCCGA
CGTCGACGTGGCATTGGGGGCCACGGGCGCGAACGACCACGGACGGCTGTCGTCGTCCAGCGCGGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGCGAGTCGTCGCTGTCGATCGCCGAGCCGCGCACGCCCCGCGCGGTGCAGATGCAGGACTTTGAAGTGCTCAAGATGCTCGGCAAGGGCTCGTTCGGC
AAGGTGTACATGGTGCGCGAGCGCGGCGGCAGCCACGACATCCTGGCCATGAAGGTGCTGCGCAAGTCGGAGCTCGTGAAGCGCAACCAAGTGCACCACA
CGCTCATGGAGCGGCGCATCATGAGCGGCACGGACCACCCGTTCGTGGTCGGGCTGCGGTGCGCGTTCCAGACGCCGAGCAAGCTCGTCATGGTCTCGGA
CTACTGCTGCGGCGGCGAGATCTTCTTCCACCTCAAGAAGTTCCGCTCGTTCTCGGAGGCCATGGTGCGCTTCTACTCGGCTGAGCTCGTGGCCGCGCTC
GCGCACCTGCATGACAAGGACATTGTGTATCGCGACCTCAAGCCGGAGAACATTTTGCTGGACGACCAGGGCCACGTGCGCATCACGGACTTTGGGCTGT
CCAAGACTGAGTGCTCGGACTTTTCCGGCGCGCGCACGTTCTGCGGCACGCCCGAGTACCTCGCGCCGGAGATGCTCATCAGCCGCAAAAAGAAGACCGA
GTACGGCAAGGCGGTGGACTGGTGGAGCCTCGGCACGCTCATGTACGAGATGCTCACGGGCTGGCCACCCTTCTTCGACCGCAACATCGAGCAAATGTGC
ACCAAGATCATGAAGGCGCCGCTCAAGTTCCCGTCGCACTTTGGGCTCAGTCAGGACGTCAAGAGCCTCATCTCGGGACTACTCGACCGCGACCCGACGT
ACCGGCTCGGCTGTCGTCCCGGCGCCGGCGTGCAGGACATCAAGGGCCACCCGTTCTTCGCCGACATTGACTGGGAGCTGCTCGAGCGGCGCGGAGTCAA
GCCGCCGTTCAAGCCGCGCGTGCGCAGCCCGACCGACATCCAGAACTTCGACCGCGAGTTCACGCGCGAGGCGCCGGACCACGCCTTCCTCCAGGTACGT
GCGCTCTGGCTGTGGCGGGTGACAAGGCGCATCGTGGTGGTGGTGCTAACAGCTCGGTCGCACTACGCGTCGGTCGTGAGCAGCAGGACCGCCGGCTCGT
CGTGTCGCCCAAGAACGAGTTCCGTGGGTTCTCGTACACGCGGGGCGTGTCGTCGCCGGAGCCGCGCTCGTCGTTCAGCNNNNNNNNNNNNNNNNNNNGG
CAGTCGTCGAGCCGCCGCGCGAGTCGCTCTCGGTTCTCGGACGCGCGCGACGGGTACGGCATCTCCTCTTCCTCCTCTTCCTCTCGCTTGCCGCCCCGGT
CTGCTGCCTCCGCGTCGTAACGCTCTTGTCTCTCGTCGGTATCCCCCAGCGCGCGGCCGACGCTCGCGACCGCCTCGCAGTGGTCGAGCCTTCGGTTCGA
AGACGACGGCGACCACAACGGCCGCCTGTCGATGGACGGACGCGAGGTCGAGAGCGGGTGCATCTAGCGAGCCAGCGAGTCAAGGCGGAGCGCCACGTAC
GAGGCCAGAGCAGCAAGACGGACTCTCCGCTCGCCTTTCATTATCCCCGCGCCGCCCCGGCGCATCGACGCGGCCGTGGCGGCGCTGTGTGCCTTTGTTT
CCATGTCTAGAGATCAAACCGAATAAATATACAAAGTGGCGGCGGGAGAACGAACCTCCTACCCGCTGCAAGATTCCACGCGAGCCCTGGCTTCTCTCCT
TCTCTCTCTATGCGGCTGTTGTCGTCACCGCCACGCGCCGAGGGTGTTCGTCTCGGCCGCTGGCCGCTGGAAGAACACGGGGAGCATCTCGCGCATCGCG
TGGCTCGGCTTGTGGTCCTGGAAGTCGTACACGCGCTGCCACTTGCCGTCGACGTTGGCGTACCGGTGCGTCACCTCCTGGCAGTGCACTGCATCGTCCA
TCGAGGCACAAGTTAGCCGCCGTCGACCGCCATCGCCATCGCCGCAACAGCAGGCATCAGCAGACCGCGAGGACTCACCATGGCACGCCGCGCACAGGTC
GTAGTCGCTGCACTCGGCGCAGTTGAACCGCGCGCCGCGGAAGTCCGTCTCGCCGCACGAATCGCAGATGAAGCCGAGGTGCCGCCCGTCCATGATGTAC
CGCAGCGTCGCGCGCGCGTCCTCGCGGCACTTGCGGAACGCGCTGCGAACGCGGAACTTGGGGATGTCGAGCTTCTCGGCGAGCTCCTCCACGTCCGCGA
GCGTCGGCGGCGGGTGGAACNNNNNNNNNNACTCGGTCACGAGCCGCTGCGCGACCGCGTAGTGCGACAGCAGCAACGCGCGGACGGCCTCGGCGCTCTC
GTCGACCAGGCCTCGAGCCGCGAACACGACGATGTCGGCGGCCGCNNNNNNNNNNNNNNNNNNGTCGACGCTTGACGGGAGGACAAGGCGGCAGCCATCG
GCTCGTAGCTGAACGGCACGGGGGCGGACAGCACGAGCGGCGCGATCTCCTCCTTGAACATGACGAGGTCGGCCGGCGTGCACGAGCAGCGGGCCGCGGC
GGCGTCGTAGAGCATCGCGGACGAGAGCGCCTTGGCCGACGAGAAGAACACGCGGCCGAGGAACTCGAGCTGTCTCGTGCGCGGGTCCAGCACCTTGACG
AACACGTAGCCGCTCGAGTCTTCCTCGGCCGCCACAGCGGTCTCCGTCGATGATCGAACGCTCTCCTTGCTCGTCGTCGGTGCAGGAAGAGCTGCAAGAT
GGTCACTGACCGCTGAAGCCGGAACGTTCATGGGTGGGTCGTCGGCGCGCGTGTCCTCGACGTAGACCTGGCAGAACGAGTACGCGTCAATGTCGACGCC
GTCGCAGAGCAGGTGGCCGAACATGGGCTGTCTGCGGTCCACGTGTGGAGCCGTGAGCAGCTTGCGCGGCCGCAGCGCCTGGCCGGAGACCACGGGCTGG
TTGAAGCACCACACGCGCGCGTGCTCCGGCGCGACGTCGTAGAGCTCGTGCAGCCGCAGCAGCAGGTCGTGCAGCGAGCAGCAGAACGGGAGCACGACGG
CGTCGACCCTGGCCAGGTCCACGAGCCCGAGGTCGTGGTGCGCCTTGAGGTCGCTCTCGAGCACGACGCGGAACGTGATGGACATGAGCCGCACGCTGGC
GGACACCGTAAGCGTGTCGTGGGGGCCGAGGAAGCCTCGGCGCGGGTCCTTGAGCGTCTCAAGCGCGCCTAGCGCGTGCACGCCCCAGTTGTTGAGGCTG
CGGTCGAACTTGTTGTCGACGAGGCACGAGTGCCACTCGATGGCGTCCGCGGGGGCCGCGTGGTTGCGCACCGCGAGGGAGAAGACGGCGCACGTGAGCC
AGTCGGGCGGCCGCTGCTCCAGGTCGGTCAATACCAAATAGACGCTGAGCACGGCGCCGGCATACTGCGGTTCGTTCGGGTTCCCATTGGGAAAGATCCA
GAGGCAGAACCGGTGGCTGCCGATCGCGAACGTGTCCGACACGATCTTCTCCACGCCCCCCATGTCCTCGCGCGCGAACTGCGGGATCGCCACGGCCACC
TCGGCACGCTGGTCACGCGAGTGCTGCTCCGTGAAGCATCTTCGCCAGGACCCGCCGTACAACCGGATCACGTCGTAGTCCGGGGCCCCGGGGAGCTGCG
GCAGCGTCTGCGCCGCCAGCGACGGCCACCGCGCGAGGCACAGCCGCCGCCACACGTCGCGGTCGTACGTGAGCGCCCGCAGGGACCGACACGCCGCCGC
ACACCGCAGCAGCGACCGCCCATCAAGATGACTTAATGATAGAGCCAATAGCTCGGCGGGGAGAGCGCGGACGAGGGACCGCGGCCGGGACGAGTCGTCC
TCCATGTCGACGTCCCTGGCGGCCTGGAGCTGCTTGTGCTGGTCCTCGTCCGCGTCCAGCGCCGAGGGCGAGAACTGGTCCATCGGGCCGTCGTCGTCGC
ACTCCATGCTCTCCGTGTCCGTGTCGCCGGCGTCGAGCCGCAGGAAGCTCGCGCGGAACTTGGCGAGCAGCGACGGCCGCGCGAACGGGCCGACGACGCT
GTTAGTAGTTGATCTACGGGCGGGGGACGGCGCCAGCACCGCCGGGCGTCGCCACT