Description :
From Genome Similarity Track
Location :
Scaffold_1762:169- 3795
Transcript NameFunction/comments
Phyta_totarag13617hypothetical protein

Sequence
3626 bases(100 bases per row)
TCGATCTGCCAATACCCGTATGCCGATCGGCAatccgcctcgatcttggtcaACCGTGGGACTTCAAAAAGCGTGGAACTCCGGTCGGACCTCTCCTTTC
TTCTCCAGCTATGTGCGTCAATCGATCAGGCACATCTCGGACCTTATCCGCCCCATTCCATAGTTCGCGCGGTTCCGATCGCCCCGCCTTTCTCTGGCTT
CTCGATCTGGTTCTCGCATCGTCCTTCTAgatcgccgtcgctgcttttCTCGCTGTCTGCTGGCTTTCTCAGGTTGGCCTGCGATTCTTATTCAGCACAT
CTCCACAACCGCCCACTGTCCGCGAGTTGTGTCGCACGGCGGCTCACTGCGGACACATTCCTCAACTTACCGCCTCAGACGCACTTCTCTCTTTCCCATG
AGCGGCCGGCCTTCAGACatctccgacgacgacgggtCTCagcctcgttctccacgCAGCACGCGGCATCTACCTTCCATCTCATCGCAGCATTCCCGCA
GGTCAGTCCGCGATACCGGACGCCAGATCGCGTGCCTCGAGGATGAACTCCACCACGCGTACAGCTCTCGAGAGACCGTTATCCAGGATCAGCATCAGCT
TAGCGATACAGTGGACCGCCTCACCGCAGACTGGCAACCTGGAACGACACTGTTGGGACCAAGAGCGCAAGATCCGTCGCCTACAGACTGAGGTCGACGA
TTTGTAACGCGGTTCCCACCTTTCAAGAGATCCAAGACCTACGAAGCCAGATCGACCAGCAGGTGACCGAGATCGGAGACCTGAATGACCGCCTGTCCCG
AACTCGACGCAGACTCACTGATGTGGAGGCCGAGATCGACCGTCTCGCGTATAAACTCGATCTCGCCCGATTCCGATCGCAGGTCGAAATCCGCGAGCGC
GATCTGGATACAGCGCAGTCCGAGTAATCTTCAACCCTCGGTAGTCTTGACCGCGTCTGGTACGCTTTGGTGCAAGCCGAGGCCGGCTTGACAAGTCCTC
ATTCGACGGGATCCCAACTCGGTGCGATCCAAGCCGCCCGCGACGCAGTGTTAGCAAATGTGACCAGACTGGAGGCGGAGCTTCGACAGGCTGCGACCGA
TCTTCGGCACGCTACTACCGCCGCTGCCCAGAATGACGCCGTCGCCCAGACCGAATATTCCGCTCTCCGTACGTAACTTGCTGGCATAACTCCCATATGG
ACCGACCCTGCACTAACGCCGTCTTTAGTCACAGGATCGGAGCTTGACCGCACTCAACATGTCTCCCGCCTCTTAGAGGGACAGCTCGTGGACATCCAGG
GATCCTACGCCTAGCTTCGTCAGGTTAATGATTGCGTGGAAACAGATATGGATCGGACTTCCGCATTCCTGACTGAAGCGGCCGACTGGGTGAACTCCCT
CCGGGACGTTCGACTCCCACCCAGGAAGCGAGGGCGCAGTCGATCGATGTCACCCACATTGGACCGGCTCTCCCTCAAACGATCTGGGCAGGGGCATTCG
GCTCCTCCCCAGGACCGATAGTCCGCGTCGACACCTTCTGATCAGGCTGAAAACGGCGGCAACCGATTTACCGGCGGCGAATCTGGCTCCGGTCGCTCGG
AAATCTCCGAGATTCAAGATGATGGTCCCACTTCCGAAAGATCTGAAGGCTTTGCAGCGGCCAGCGAACACGGTGCGAGCCATCCTTCTAAAGCCGAGAC
TTCCGAGCCAAAGGAGGATTCCGAACTCAGTAAAGGaaccgacgacgaagcgttGGCCGCCATGGCTTGATCTAGATCGGAAGCCCGGCGTCATTCAACG
CCTGCTCTCGGGGGCAACGCGTCTCAGCCGACCGTTGATCCTGGCCCTGATGGTTCCGGATCACCTTCCGGTACttccgccagctccttccgGTGACTCT
CCGCCCCAATCTCCGCCTAGAGGATCGCCTCCAAGCGTATCGCCGCGGTTGATCCCAGCGATCTTCCCGATCGGATCTTCGGCCCCCGGCTTCGATCGGC
CCCGGATCCTCACACAAGCTCAGTCAGATCCGTGGCCAGCCTCTGcgctcaaccagctccagatCGCGGCCATGATCATGAGTACTCTTACTCGTCAGCT
CCCAATCCAACCGGGTTGCTTATTTCGGTTATTTCCCCGTCGTGTCCAAGGAGTTGCGACACCTCGACCCGGTACTGGATACCGAGACGACACAATCACC
GGCGCGAATCTCACCGCCCTGATGGGAGATCGCCCGTGGCAAGTCCTCGCGAATCCTGAGGCTCCATTGACGTTTGATCTTGCTCTACATCGAAGGGCGA
ACACCTCTCTAGGCCAGATCGTAGACGCGTAGCTGACTTTCGAGGAGTCTCACCTTCACGCTTTTTGGGAAAACACACACTACCTCCCGATCACTGCCGC
ACAGCGCCGTGCCGATCCGGTGATAGATCGCTACCACCACGACCGTCGGCAGCGAAGGATCAACGTAGGCGATCAATGGCGTCACCTTCTGCGCGGCTTC
TTGCCGATGATACAGGAGCAGTGGGCCGATCTCGATCTGCTCCTCGATCCGTTCTTCCTTCATCTCCCGACTGTCCAAGATTCGGTGATCTGGTATCCAG
GGGTGAGTTCGCGCACGGCGAACGCTAGTGACCCCAACCAATACCAGTGTGGACCCGTGGATCTCCGAACGTCCGTGACTGAATGTGACACTGAAGATCC
TTGGCCAACCATTATCGCGATCATCCCGCTCTCCAGATCGGCCGTCTCCCCAACAAGTTCAACCCGCAAGCcggggctgctgctggtgctttCCAAGCTT
GATCTTGATCGACGAGCTTCTCCCCAAGTTCCTCAACTTGGAGATCGCAAGATCGCCTCTTCTTACGGCAGGATAACCCTTGCGTTCTACGGCCGTTGAA
TTTGAACATCTTCTCATCGCCAACACATTCTTCCCTTCTTAATCTAGCTTAGTGTCTTCCAATTCTTGTTCACACCGTTCGTTACCACTCCCGATCTCCC
TTTTAACTTGCTGCGCCAGATCGGTACGAGACCTGCCCGTCCCGACCGACCGGCACTAGGATGGATCGGGTCGATCTCTACTCGACTTCGGCCAGAGCGA
TCCATCATCCCCTTGACTCGATCGGCTGGTGACTTCCGACGTGGCTCAATGTTCATCACCCCCGAAATCATAAAATTTGCCTTCGTATGCATACTCACAC
ACATCTAAGCCTTCCTCCGATCTACGGGCTCCCCGTAGATCTAtcatccagctccttcaccaagGTGACCATTTCACCTTGGTGGTCCGATCTCACTCCT
CCTCGTGAGACTGCATCGCGCCAAACCGGTTTCGATTCGGACGATCTCGATGGTACTCGTGTAGCAGCGCTCCACAGTTGAGGTCGACTTCGTCTACCCA
GCTGAGATCGTCGTAGCCCTTCCAGTGCACAAGGAACTCTCGATAAGTTCGGCCGTACCGCGCCCGTCTACCAGTTTTCATGTCAgtgatcttctccact
tcgtattCGTTCGCACTCAGATCTGGGACCCAGCTGTCCTCAGGCAGCAAAGTCTCGTCGAAATCCAGCCGATCGGCTTCGTCCACGGTCAACTCGATCT
GCGGCCGGTCCGGGAATTCACTAACC