Description :
From Genome Similarity Track
Location :
Scaffold_2513:169- 2143
Sequence
1974 bases(100 bases per row)
AGTTCGGGTCCAAGGAGGGAGGATCCCGCATAGAAGGACCTGGATCCAGGGTACAGGGATGAGGGATGCAGTGGATCTCGAACCTTCGTGGGACAATGGA
GATCACAGACGGTTGCCAGATGATGTTGGATGATTGGACAGCTCAGATCCACGGCGAGTGTACAATTACAGTGAGGTGGATCCAAGCGACCTGGATCCGG
ATGAGTGTACCCATAATAGGGTGACCATGATGATTACGTCATGGATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGAC
ATGCGGCCGAGCCTGGTAAGGGATTTGACAGGTAAAAGACATAGAAGGTAGAAATTCAGGCAGGTATTGGCTTAATTATCAATACAGACTTCTATTTGCA
CGATAACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCGGAGAAGGTTGGGAATTGCGAACCTAGTGTTAGTAGTGA
TAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTATACACGTGCAGATCCAACAGGTTAACTCAATTACTACTTGGTCGGTTACA
CCCTCGAAGATCTCAACTCTCAAGATCCCGTCACAGAAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTA
CGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACCATCCACGGACGCAGAGTGAAGATTTTTCACTGCTGC
TCCACCCCATCCCACGTCTCGTCAAGACACTCAAGCTTCACCACTTGAACTCTTTGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACAC
AAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCAGCAGTCTCGCAGA
TTTTGCTGATCCCGCTACGCCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTG
AGCCAGGGGATGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTCCTGGGAGGAACTCTGTCGA
CGGAAGGGATCGGGATCCGGATCTAGAAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACTTGCGTCAAGATCCGCTAAC
AAAACAAGGGAAAGTGAAGGCGAAACGGTGTGCATTTGCAGATTCACCGGTTAAGTCAACACCGTACCTAAACCCAACCCCGCTAGTCGAAGAAACGAGA
AAGAAGACGAAAACGAGTAAGACTACACGGAGGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCGGGTCAAGCTGGTCCGACAAGGATC
TCGACTTCGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAAATCGAAGATCCAAGGGAACC
GGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAATCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTATTCGACGCA
GAGGATATCTTCGAGCTAGATCTGGGATCTCATAGCATCCGCGACGCAGGACCTCTTTGCCAGAGCTAAGTCCATCTCCGGAGAAAGGTCGCGCACTATG
GATCCAGTGTCGTCGCCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGAGGAGATACGTCGTCAGAGCCACGACGCATGACTTT
AGGACCCTCCGGAGCATCCATGCTGGAAGCGCGGGCGAGGGTCCGGGGCCAGGAAGCCCCTGTGAACGTGAAGG