Description :
From Genome Similarity Track
Location :
Scaffold_641:169- 1861
Transcript NameFunction/comments
Phypl_g10005hypothetical protein

Sequence
1692 bases(100 bases per row)
TACCTCAGCGGCTCCCATAAACTCTGCAGACGCGTTCGCGTTCTGGCGTGCCTTGCCGGCGCCATTGTTTCTGGCAGAGGTGGGAACATGACTCACCAAT
GCTCTGCAGAAACTGCGGGCCGGCTGGCCCCGATTGCCGTGCTGTGCCAGTCAATCCAGGGCTCGTGTTTCTCGAGCCACGGCAAGCCCCATACTTGTCC
ATATCTAGAGCGAGGAATTGCTCTGTGCAGTCAAAGTCCTCGAACTTAACAGCAAGGTCTATGTAGACTTTTCGTACGTCTACCACTGTACTATCGGCCA
GACTCACGGAGACCAGACCTTTGCCTTTGCTCTCGCGCAGAGCATTGGAAAATCTGTTGCTATTGTCAGGGACTGTTTGGCGGTGTGCGAAGTTCTTAGA
GTCCCCAGAGTCGATCCAAACTCGGAAGGGATGATCGTATCCCCGTACACGTGCGTGTACTACTAGCAGCCCACCGCTACCGGGCTTCTGTTCGAGAGTG
CAGAGACGCTCAGGGGCTAAGCCTTCATGGAGCGTACCACCCGCGCACCGCTCATGAAGACTTAGATCTTCCCAGTAGGGCGCCCTGCCCCTACTGGTGT
CCAGCATTTAGGAGCGCCCCTAGCAGAGCTTTTGCTCGGGCCTGCGTGGCCGTCCCACGCCGAGGTGAGGGTGCAGCCTTGATTGCCGCTGTACTCATCC
TGAAGGACGATCTGGGTGCTGACTTGCACGCGAAATAGCAGCGTGCAAGCAGGGCCCACACGGAGTCCGTCCAAGAACACCGCCACCTTAATGTGTTCAG
GTAGGTTCTCCACTAAAGATGCAATTAGCTCGCACATGTCTTGAATGTACTCGCGCAGCTTACGTTTCCCTTGTTTGCAAGGAAGGAAGCGTGAGCGCTG
ACGATACTCATAGTTCGCCAAGAGGAAAGCGGCTCGCAGCTGTTCACAGTGGGCTCAGCTGTGTGAAGTTCAGACAGCTGAGCCCAGGATGTGAATCATC
GAGGCGACGTCGCTTCACGCGTGTACGCCGAGCTCTTGGTTCCACCACTGAGATGCGAGAGCGCAAAGGCGACACGAAGTCGCTCGTCCGAGAGTAGGAC
CGCGCCCATCGCGAACTCAACCTCTCGGACCCAGAAGTGAAGGTCCTTACCTTGCTTCCCGTTGTAGGCCTGGACCATTAGCATCAAGGGCTTCGGCTGG
GCCGGTCTCGGTGCAGCCTGGGGAGGCTGTAGCCCCTGGACAGGAGCGATGAGTCCACGCTCATTGGTGTCGAACGCATTCACGCGCTCGACCTGTTCGG
ACGGTGTTGACACCGCCACGCCTCGGAAGGCATCCATCCCAAAGATGCCCGCCATTTTCCGGACTGACTCAAACTCGGCGTCGGTCAAATGAGGAAAGTC
TCCTCGATCGACCAATGGTGGCTCGCTTTCTTAGAGACCACAGAGGATCTCAGGTAGTCCAATCCACCCGCGTAGGTGTCGGATTGACTACAAGTGCTAC
CAagtgtgacgggctgtcgAGGAAatgtgtgcttcggagttaatacaaactcccagtgaacggCAGTTCACTTAGTCCTTGGCCGAaaggggactggtac
caaaGATAAGGTAAAGTAATACTGAATATATTCAGAGCCCAGATTGTCCTGCAATACAATACCTATAGTAAATCTATAGAAAGCCCCCAGTG