Description :
From Genome Similarity Track
Location :
Scaffold_3936:169- 1746
Sequence
1577 bases(100 bases per row)
GTGGATTACTTAGGTCATCGAGTCTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGTTGGCAGACTTGTCCTTCCCACAGTCGTTACGGG
CGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCGTCGCGGATTATGCTGCAGTACTCTATGAATTGAGAGAGGTAGATTTTGCTGCGAT
GACTACTTCATCTGTCCAGATCAAAATCCAACAAGCTATGGCCCTGAAGATGTCGGATCCACAAAGGAATCCAAGTAATACGACGCCAGAAGAGGACCTG
AAACAGGAGCTGGATCCACCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCC
GAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTTATAGTTTATGC
CAGTGACTGGGCAGTCTCAGCAGCTCTGGTTCAAGAACATGAGGGGATTTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAATTGAAC
TACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAGTTACAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACT
CCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTAGACGCTGGAGATTGTGAAGTGTTC
GAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTGAGATGGATGAGGCGCTGACTAGGATCGCCCCTAAGAAAGAGCCC
AAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGTTCGTGTACGACGCGGAGGGGGAG
CATACAGTGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTATGCGGAGGGCCTCACCGTCAATGAAGCAGAGTATAACGG
GCTCCTGCTGGGTTTGTATCTACTAAAGGAACAAGATCCGAAAAGGTTGGTGACTTGTGGAGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATT
GACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGTTGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGA
ATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCG
ACTAGACGAAGTGGTGGTAGTGGGATCCAGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTC
GAGGAAACATTTGTGAAGAGAGTCCGCATCAGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGAC