Description :
From Genome Similarity Track
Location :
Scaffold_2342:169- 1297
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_2342-snap-gene-0.1ATP-binding Cassette (ABC) superfamily

Sequence
1128 bases(100 bases per row)
TAGAACGCAGTGTCCGCGTCAGTCAGGTATGAGACAGCGTTGCCGACGCTCTGTGAAGTCATGATGATAGCCATGAGTGAGCGCATGAGCTGGCGGAACG
TGATGTCACCGCGGTCGACAAGCTTGCCGCCATACCAAAACGCGAACGCATACGTGGCGAACACAATGAAAGAGGAGAAACCGACGGCGACGCCATTCAC
TTGTGCCTCGCGCTCGCCGCTCTTCATCGGTTCGTCGAGCAAAACTTCGAATTTGTCGCACGAAATCTGCTCCATACCGAGAGAAACCACGGTGCGAATG
TTGCCGAGCACCTCCGACGCATGTGCTCCTACCGCAGACAAGTCGTCCGAAAGAATCCGGCTTCCGTGCATTTTCTTGGACCGGAATATGTTGCCAATGA
CCAGAACTGGGACGATCGCTAGCATGACCAGCGATAGCAGCCAACTGCCGGTCAGAAAGGAGATCAAAAGGCCGACAACCGTCGTGAAAATAGTCTGAAA
GAGTCGACCTTGAGCCTCGCCCGTGATCCGAGACACTCTCAGCGCGCACGTCGCCAGATCTGCTGTCAAAGAACCCGTGGCATTGCCTTTTTCATCAAAG
AAGCCGACATTTTGGCGGCAAAGCGAGGTGAATTGCAGATCGCGAAGCCGAGTCGTGAGTTTCTCGGCGATAAAGTTGAAGCAGTAACTCTGCGTGGCGA
ACCCGAGAAACAGAATGACAGCACCGACAAAGTACATGCTCCCGTACAGCGCAACCTGATGTGGTAGGTTCGACATTGCCGAGAGATCGTGCGACGACAA
ATACTTGGTGTACTCAGCAGTCATGATGGCCACGAGCTCGCTGATGAGAACAGCCGACATCGGAAAGGATGCGCCGTTGATAGCCGATCCCAGCATCCCC
ATCACGTAGTAGCAGCGCTCCGGCTTGCTCATGGCATTCACATCACGAACGCTGAACTTTGGCTTTGATCGCCCGTTTGTAGTCGCCGCCCCGCTCAAGT
CGTCATCTTCGCTCACGGTATGGTCACTTTGCAAGGAATGGCGACTCAGTTTTCGCGAAAACGGGTCGTCATCTTGCTCCAAGCGAGCCTCTTCCAGTGC
TTCAGCTGCAGCCTGAGCTTCCTCCAAC