Description :
From Genome Similarity Track
Location :
Scaffold_4129:169- 1173
Sequence
1004 bases(100 bases per row)
GCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTA
CACGCCTCCAGTAGAGATGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACG
GGGTCTCAGAATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTGAACTT
ATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCATTCGAACAGGCCAAACGGTGTGATGAAT
GCGGATATTGCGCGAGCTCGATCCGTCATAGTCACCACCCCGAAACCACTGGCCATGTCAAGAGAACAGTACCAGAGTAATTTATCCAAATCTTCCAATA
GCGCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCGATGCACAGACGTATATCCACCCCGTTCTTCTTGAT
GATGATTACCACCGGAGATGCCCACGGGGACGTTGAGAAGCCGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGACCGTTTCTCTCGGAACTGA
GGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGTGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCTTTAC
CGATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGTAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGAC
CTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCAAGATCTTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCT
TCAG