Description :
From Genome Similarity Track
Location :
Scaffold_31:16895- 26149
Sequence
9254 bases(100 bases per row)
ACTGTTGATCGTGTGAAGCATTTCCACGCGACCACATACCACCTATCCCCAACTAGGTCAAGACAGACATCGACCTCAAGCCACTTAGAATAGTGAAACC
CACCCGCCGACGAGTACACAAGGTGAGAAGGAACAAGATAAGACACACGGTCCGGATTAACCCTCCGTTAGTCGGTCGTCCGGGCGACAGTGGAGAGTTG
GGATCGCTTCGCAAAATGAGCGAATACCTCTCCACCCCAATGGTGCGCGTGCCCGGATCTTCTGGTGACTCGGGATTTCATCGTGAATCTCAGAGCGAAG
ATGTCAAAGTAAAGGTTGAACCGGGGATGGAATTGTCGACGAAGAAAGGATTGTCGCAGACACGTAGTCATCAAGCATACTCGGTTCGTCAAGGTTTTGG
AAGGGTGAACCGAAATTAAAGAGGAAGATCACTCAGGTGATCTCGAAGAAAAACCTCTATTCCCTCCTCAGGTCCCTTCAGGAACCACCGCGGATCGTAC
TGCAAAGTACGACCCGCTAGACGGAACACGTCCATTCAAAGCAGGACATGTTTCGTCTAAAACCCAAACTGTATACAAAGAAAAAAGAACGAAGGCTACG
GATCTAAGCTACGAGCGCCTGACTACAAGGGTGGCGATTAGGAAAGGAGTGGGGCAGCAGGGGTCAAGACGAAAGGTTGGAAGATGGATCAGCTACAACT
TCGTTTGTACTGAACCCATCTTCAAAATTTTCTATTCACAGATCCGGTGCTCACAATCTTGGAACTGGAGCTGATCGGACCGATACGAGGATCTATAATG
GAACCACGAGCTGCAAGTTAGATGGAAGCGGAACAACTTCTAAATCAGTTACTACAAGGGGTAGGCTTTGTACCGAGGGCGTTCGATGCTCAGGTTCTGC
TTGACGGCGACCTGGATCAGGTGACCACGACCAGTTGATCACTGTTCAAAGCGCTGGTCCCACTGACCGGTAATTATGACTCCGCTGATCGCGAACTCAC
GACCACCGTCGACATCAAAGAGTAAGTAAATTCTATGGCTGTGTCGTCGCATTACGCCCCTGCGGAGTCGGATGCAGAGGTAAGCGATGACATGGAGATC
AAACGAATGTCGCTGGGACCGTTCGAAGCAGCATTTTTGCGTGACCACTCCGACAATACGGCTCCAACCACCAGGGTGATGGGTTCAACCACTACGCAAG
TCTCTGCTATGAATGAATCCGACCAGATGCAAATCTACTTTGTAAAAGCCAAGGAAACGTTTTTACAGGACCAATACCGTCGACCGCCCCATACCTTGCC
GACCGGTCGTCCCACCCCTAACCACAATATTCAGGGCGTGTATGCCGGACACCAACATGGGATTAGCTGACTCGCATGAAGGCCGCGGATACGCACGATC
TCGATATAGACGGCCTCCGACGACACCACTTGGCTACTACTGATGCCATAACAGGAGAAGGTTTTGCTGCGCAACGGATTCCCATGTATGCGATTGCCGA
GGTAAAGGGATTTTCGGGCCACGATCACGACGATGACCGCGCTAGAGGATGGGTACGCAAAGTCAGGTCAGCTTTCTTGCGTGACCAAGCCCCCGACTCG
GAGAAGTGTCTGTTTTTGGTGATCTGCTAACGGGTCCAGCACAAAACTGGTATTCCCAATGAGTCAATCGACAAGCAATAAGCTTAATCAAGAGCTTCCT
CTTACAATACTGTGGACGCGGCGTCTCCGCTGGTCGCCAGTATTATCATGCCTACAAGCGTGCCGATGAAACTCCGTCAGAATATCTCTACCGATTGAAC
GTTGCTGGAATGCGAGCGAAGATTCTCGCGAAAGACGGGAATATCGCTGATCGCCGTGCCATGTGGAACACTATATCAAAACACTGGACGATCAAGACCT
CGCGAAACAATTAAGACTTCTGCGATTAGATGACGTGGATACACTGGAAGCAACGCTACACACGTAAGAACGTATGCAGAAAAGCAAAGGCAACAGCCCG
GCCACTTCAAGAAAGTTCCGCTTACGATCAGCATCATTACACACCCCAAGTCCATCTGAGCCGGCTCTCTGTGCGTGCAATCCACGTGGGGTCGATAGCA
GTTATTCGGAAATAGATATAAGCGGTTCATAATTAAATGAAGAACAACGACGTTTTTACAGCGCCACGTAAGCCGACCAAACGATGGATCAAGAAAATGA
ACATCCGACCAAGCCAAGACTGGGTGACTGGTAGCGTGATCAGGATCGTGCAGGAGGACACAAGTCGTGCACTCATCGTGGGTCGAAAAGACATGATTGT
CGTGGATGCTAAAAACGATTGACTTGACAGAAATGCGGATGCCGTGGTCACCCCTCTGACAAATGTTTCTACTGGTGCGCAGCGTGTGGAGAAGTACACG
ACGGAGGCAAATGCCCGATAAAAAAGTATTACAAAATGCTTTGGAAGTAGTACGTGCCGACCAAAAATGCTGGAATGCTTCCTCCTGACGCGGAGAAGTT
GTTAAACTAAGAAGCTCGCCAGGTTGGAACCTAGTACGAGCCGAGCGTTATCGGCTATGCATATATGTATTCATTGAGAGAGAAGGGGTTTATAACAGTG
TTAATCGCCTGACCATACAGACGTTCGGTACATGTGGTTTGGTTTCTAGTTGTTGTCCTTCATTTGCAAGTCTGCGGCGACCGGACGAATACACACGATC
ACCCACCAAGATGGAGCTCAAGTTTCCTCACGTGGTTACTGGAAGTATCATACATTAAACAAGTGGTTCAGAAAAGCCAAGGTAGGGGGAAATCAACAAT
GAAAAGGCCACCCTACTGTTTGACTCGGGAGCAGAAGTATCGATCATCGACACCACCCTGCTGGCCGTGTCATAGACGAGAGTCAGAAGAAAGAATTTGT
GGATGTTGGAGAGAATTTATACATGGACGAAGCCCGCACGAAGGTGAAGATCACGCTGAATGGAGCGCTAGTCTACTACTTTGATGTATGGGTCAATGAC
CAAGTGGGACAAGAAGCAATTCTAAGAATGGATTTCACGGTACCGGCCGGAATACGCCTTGACCTGGCGAACGGGACAGTATTTTTGCCGGACGAAGTTA
GAATTTAAGTGAAGGTAGAAGACCACCGTATGGGGCGAAGATACAACGAATCACTGCGGATGTGAAGCACTCGGAGATCCCAGTGGGTAACTCCGTGGAA
GTTAACGTTGTTCGAGGACCACTGCAGTCGAAATTGTGGCTAACACGCCACTCATGCTGGGTACCTACGACTACGACTGGACCCGGAAGGCAAACGTACC
TTCGCTTGACCAATCTGACTGATCAAGAGGTGATTATTCAACAAGGGACGCCATTCGGGCAATGGATGCCAGCGGATATGATACCACGATTACCCGGGTA
TGTGTCCGTGTGGTCACGGCGATATCAGGAGTGGCATACACTCGCGTTTGAAGCTACTACGGACGAAGAAGAAGAAGAATTACCCGAAGTATATGGACCG
TTGGTCGAACACCCGTTATACCCAACGCCAACGCGCATTCTAAAACGACCGCCGAAAGATATCACAGAGACGGCCGTAGAAGTAGAAGAAGCAGAGCTCG
AAGGTGATATACCGATGTGTGATCACGTGGACGAACAAGATAACCTTGAAGGACCACAACCAGGAAAATCGCCAGTGATTATTAACGCGATCACCATACT
TTGTAGGACTAGTGACGGGTATGACGGTGATGTGGGTTGTGATTCGGTGTCTGATCAGCTGGAGCGAGTGAACCCCAAAGGAAGTATCGATGCGTTTGCC
AGCGATTGCCGACATGGAGACCCCCATTGACGTTATGGGAGACGTCACGTTGGTGCGGGACCATTCAGAAACGCAGTCAAAAGAGTGTAAGGGGAAACTC
ACTCCCGAACCGATTAAGGAAATGGTACCTGATCGTATGCAAGACCGGTCCACCAATCACCCAGACGGGACTACTGGTAAGGTAGATGAGGTGCATCCAC
CATCCGACCATCAGGCGATCCAAAAAGCAGAAATCACAAGCGAAGGAGCACGCGAATGCTCGTCGTACCATCACGAAAGTGTAGTGTTGTTCGCGAAAAA
TGCTGGCCAACACATGGCAGTCTTACCAGAAGTAGACGTAATGCTGAGCGAGGTATAAATTTTTTCGACATACAGGTAGGCGACCCAGGGGTCCCATTGA
CCAAAGAGCAAGAAGAATTACGTCAGCTGATCTGGAAGAAACGACACCTTCTGATGGCAAAGGAAATGCCCTCCCACCTGCTGCGCGAGGTGTAATATGC
GATATAGATGTTGGAGAAGCAGCCCCGATCGCACAAAAAGGCCAGTTGCCCCAAAGCTCCGTAAAAAGTTGGCGGACCTGATTAAAGGGTTACTATCAGC
AAGAATCATATGTTCCTCAACTTCGCCATGGGCGTCGCCCATCGTAGTGATCTTGAAAAAGAATGGGGTGAACATATGACTATTTATAACTACCGAAGGA
TTTCCTAATTGACGAGGCTGATGGTATATCCCATGCCCCTAATCAACGACTTGTTGCAGGATCTGGACAAAGCGCTATGGTACTGTTCATTGGATATGGC
CAGCGGATTCTGGGTTGTGGAGATGGCGGAAAGGGCACGATTGATCTCTGCTTTTATCACGCTCTCGGGTCTGTATAAATGGTTAAGCATGCCGTTCAGG
ATGAAGAATGCGCCGCAGATATATCAGCGTATGGTGGATAACGCGTTATATGGATATCTTATGATCGGGGATCGGCAGAAGTCAAGTGACCACGAGGCGT
CTCAATAGATCGATGTCTTTGCAGACGGCGAGCCAAAAAGTGCACCGAAATCCTTCGGTTCTCGGAAGAAGGTCCTAAAAACATTAATGACATTATAATT
TCAGCGTCATCTTGGACGTCTCTCTATCGAAAGGTGGAAAGACTGTTGAAAGTATGTGATCAGTGTAATTTGTTGATCAGCCTACCTAAGCGCGTCTGGG
GACGAAACAATGTTGAGTACCTCGCGCACTAAGTGTTAATAAAAGGAATCAAAGCGGACTCGAAGGATCTCGGGTCGTTGGTGACATTCCTTTTGCCCGG
ACACTACGGTCAATGCAGTCCTTCCTAGAAAGCCTGAACTATTACAGCCTGTTCATTGAAGTTTTCGCCATACATGCGTCGGTCTTGTACGAATGGAGGA
AGGCTGATTTTCATGAGATCAGGTGTTCGCATAACACGGAAGTTGAAGGCCCACCTAGCTATGATCATGGCCATTATACTGAGATCGATAATGACAGCGG
GCAGCGTCCAACAGGTGATCATGATCATCCACTAGTGACAACGAATGGTCAGGTTCCGAGTAAAGTGAAAGATTCCGATGGAGAACATACTGTCGCTCTT
CGTTGGGAAAAGCCAATATCGCGTTCACCATATAGAAGGCTAAAGTAGCCAAAACCTCGGTACTAAAACATTTTGATATACACCGCCGACCAGTGATCGT
AATTTATGCTAGAAAATGGGCGGTATCCGCAGCTTTGCGTCGAGAACATGATGGAGTTAATTGGCCTGTTAGGTTCACAAGTCGAACGTTAAAACCAAAA
GAGGTCAATTATGGAGCTGTAGAAAAGGAAGTTCTGGCCCTGCTCCGGATGTTGGATATAAGTTATACGCTATTGGTCTCTCGGGATGTTAAGGTTCTCA
TGATATATTCTACCTTGGCATGGTTGATGCAGTCGTCAGGTCTCAATGGACGACTTGGCAGATGGGCAGCTTTACTGTCGACTTGGACGCTGGAGATTAT
TCAATGGAACAAATGAAGGACGAAACCCTCGGCACCCTTGCAGCAAGTATTACACCGCGGGAAGATATGGATGAAATGTTGATCGCGATTGCATCACGGA
GCAACCGATACAGACTATCAGTATGCCGCCCCTACGATCAGACATGGCGAAGTACTTCTGGTCGTCAGCTTTGACGGATCAGCACTTATCAAGAAAAGGG
TGGGACTACAGTGCAGTGATATCGAAATACCCGAGTAGACCATATTGTCGGCCGCGTCGCGTTTTGACACTGGATTAACATTGAACGAGGCAGAGTATCA
CGGGTTACTGCTGATTTGCGAGCTGCTAGCGAAATAGACAAGGGGACGAGTGGTCATTTGTGGGGAGTTCAACCTGGATATCAGGAAGATGCAAGGTGAA
ATTGATTGCAAGGCACCAGGAATACAATTGCTGCGTCTCAAAGCCCTAGATCAACTTAGGTCGTGGCCGACATATGTGTTCTTACACGTAAAGAGCGATT
GGAATCAAAGTGCAAATCGACGGGCTAGCACCGCTTTACGAATGAAAAAGGGCATGAATATGCCAACTGATCAGGGCCGCCGCGATCTGAACGCTATCAA
TCGGCTGGAAGAAATATTGATGCCAGCGGGCATTGATCAAGTGATCAAGATGGCGGCAATTATGCGATCTACCATGCGAAGGTGTGAGAAATATTTATCA
TTATACACGACGACGTAATACAGCAGATGCGACTCGACCGTATAGAACTGGCACAAGACAAAGAAAGTTGGATCGCTAACCTCAAACTTATCTAGTCGGA
GATGTAACGGAACTGGGTGCTACAGAAGCAAAAGAAAGAGCTATGATTGCCCCAGACTACGTGAGAGATGAAAGCAAATTGATATATTTTTTCCCACGAT
CGGCGACAAACCCCGATGATCGTGAGCTAGTTCGACTGGAAATCCCGGAATTGCTCCAAGATGATATTCAACACCACTACCACGCAATTCTGGAAGGTGG
TCATTAAGGGGTAGGGCGCACGTATCACCGCGTGCGATCACACTTTCATTGTAGAGGTTTGTTCAGAAGTGTGTAGCAGTATGTGGGGAAGTGCGTCGAC
TGCGAAACCGGGAAGGGATTTCTGGCGCTACGAGGAGAAACCCCAGGGAAACGTGCAAGATACGTGCTCGTTTCAGATTATCGCAATGGATTATATCCCT
TCTCTGTCCCGGTCATTCAAAAATACAGTGAATTGCTTTTTTGGGATGATTTGTTCTCCGGCTACGTGATCGCTAAGGCTAGCTTGTCGAGGACGGCCCA
AACGATCGCGGAGGGATATGAAGAATGCGTTGCCCGGAGATTTGGAGCGAGCGAATCTTTTCGTCATGCTCGCGAAGCTGGGTTCATGTCGTATTTCTTT
CGCTCATTCAACCGTATTGCCGGCCGAAAGCACCGTGCTACAATGACGTATCGGCTTCAGGCAAATGGCACCGCCAAACGGATGGTCCAAACATTGACCA
CGGCGCTCACGATGTATGTCACAGACGTGAACCAACGAGACTGGAATGAGTACACCGAGCGATTGACCTTCGCCATCAATACGGTGCATGATCGAGTCCG
GGGTGATACTCCGTTCTATCTCATTCACGGAAAGGACCCTCGAACGACGAAGGAAGCTACTCTTCCGTTGGGATGCACCAAACCACGTGATCGTGACCCC
AGGAGATGGCGCTATCACATACAGCGACAGTACCAACGTGCCCGGGCCACCGTGAATGACTGGCTGAAAGAAGCTATTCAGGACCGAAATGATCAACACA
ACAATGATCAAGGGTCACATGGGATAAGCTGTTGTAGCCAAGTGTGGCTGTATTTGAATCGAGTGAAAGAAGGATATGCCAGGAAGCTGGCTCACATGTG
GCATGGCATATTCCGGGTGATCGAAAAGTGTGGGGAAAATGCAGTACGGCTGGAAGTGCGAAGAACACCATACCGATTGTTCCCGCTCGTGAACATCTCT
AAGTTAAAATTGGTACGAACTTTTCCTGACCGACCTGGTGCACGGCTGGAGGTGAAAGAAACCGAACGAATGGATTTTGATGAATCTTAACTGCCGGAGG
GCAGTTGGGAATGCAATTTAGCCGAAGGGGAATACGAGGTGGACATCATTAGAGATATGAGGTCGGGGCAATATTTGATATGGAAGAACACACTGACAGT
TCCTGGTCCAGTGGAAGGGTCATAATGATGAAACATGGGTGGATGAAGCAAACCTCAGTGGCGCATTGTTGCAGGAATTTGAATGTGATCTAACTCAACG
GAATCGGGTTGAAGTGATGCAGGTACACGAAGAAGAATCCAGATGTTAGGGCGACCAGAGGCGCTTACCTCGTGACGACGAATGGTGATCGTCTGGTTTG
CAAGCGGAAAGCTACATAGACCACGCGATCTGGCAAAGGGGAGGATCCACATGGTTAGCAAACGTAACGATTATGGAATAAAAAACAAAAGCGAATGAAG
CACAACGAAGGCGCACTTAGAGTCACGACATGCGGTCACGACTGCGGCCACAAACACAATGGTCCTTTACACCAGAAACAACCGATCACTTTTTTACGAA
TTTGTTCTTGAGGCAGTCGATGGACGATCCCGGGTGATCAGCGATGGCCGTCCGGTATTGATTGCGTCAGTGATCGGCGGAGTCCGTCAGGTGCAAGGCG
GAGGCCAAATAAAGGATTTTGGTTTGTCGGCAGCCAAAACCCGGATGCCACAGGCATTTCTTCAAGCGTCCGGGAAAGTGCAAGAAGAAGGGTTCTAATA
GGATGTTGAGGTCGCACTGACCCTCGACCAATCCCTGCAGCACGATCTGGAACTCATACTTCCACCGAGGACCAGATCGGGAACGTCGGCGGCGCCTTTC
CTCATACTCATAGTAGACGCTCATACCAGATTCATTCGCGCGGCTTGAAACGACGATGATTGGTAGCACATGGGTGGACTTCCACAGCGCCTGGCGGTGA
TGATTATTAAAATCACGGTACGCTGTCACCAAGGATTGAAACCAGCCGGTCGGGCGAAAAGACACAGATGCGATCGGCCGATCCAGGATGTCCCATGGTC
TTTGACTGTAAAACGTAGCGATTTGTGCCGAGATCACCAATCGTGGAGACCATTGGGACTCTATAGGCGGACGAGCGCGAGGTTCCGGAACGGAAAACAA
GTAGTGCTTGGGACGAGAGAAGTGGTGGAACAAGAGGTCCAAGTCTAGATCACCCACAGTGGACAAACCCAAGCAGCGAGCCGACCACGGCGCAAACTGA
CCAGGGACATAAGTCGCACGAGCGCAATACCCAGGTATCCACTTAGCACGCGAGGACCGCACGAGGGCAAGGCCTTGCGAGCAGTCTGAGAGAGGAGCTG
ATTCACCATGACGTGACCGCCGCTTGACACACTGATATACCCATCGAAATCGTT