Description :
From Genome Similarity Track
Location :
contig_6:168949- 171247
Transcript NameFunction/comments
g1791.t1hypothetical protein
g1792.t1hypothetical protein

Sequence
2298 bases(100 bases per row)
CATGGAGACACCGCCGAGCATCAAGCAGCAGTATGCGAGTCCGCCGCGCGAGGCGCCGGAGCAGCGGCGTAGGCGATTGGCCAACCGGCGCGCGGCCAAG
TACCGGCACTTCCGGTCGCTGGCCCACGCCGCAGACCCGACGGCTGCACTCCAGAGGCAACAGAACACACGCCGGCAGCGAGAACGGCGGGCACAGCTGG
ACGACGAGGCGCGCGACCGCATGCGCGCGCAGAACCGAAGCCGCCAGCAGCTCCGCCGCCAGAGTTTGAGTGCGCGCGCCAAGCAGGAGGACCGCGAGAA
GCAGCGCACACGGCAGCGCGAGCGGCGCCAAACGCTGAACACCGAGGCGCGAGAGGAGCTGCGCGCGCGGGAGCGGCTGCGCGTCCGGCGTCGGCGCCGC
CAACTAAAGGCCGCGCTGCCGGCCCATTGCATGTACAGGAGCGCGAGCGGCTGCCGCATCTGAGGCTGGCGCCGAGCTACCAACGTTGCGCCAGCATCAG
GAGCAGCAGAGACAGAGACTCCCGTTCGGAGGCGGCGTGCAGATCACGCTGCCGCCGCCGCCCATGGAGCGCGTCCGGACGTTCCCGTCGCTACCTCATT
TGCAGCAGGTGACGAGACCCTCGGCGTCACTGCTGCTTGCGACGCCCCCGCCGTCGTTGTTCCCCATGCCCGGGCCGTTAGCGGCGACAAGTACAATACC
AGGTAGTGCGGCGTCGGGACTGCCTACGGTTGCTAGTGCAGTTGCCGCGGCGGCCACGAGACCGACGCCCATCATGCCGTCCGTGAGTTTGCCGCTGCCG
AACAACGCACTGGCGGCTCTGCCGATGGCACCCCAGCAACCGCCACGGACGCCGATCGTGCTCCCACCAGCGCACCGTTCGCTTCCGCCACTGCCGGATT
TCTTAAACAGCCGCGAAGCCTTAACCCCGCTACTGCCGCCGCTGCGTCTGCAGTTAATACGACACGCGCTTCCCGACCTTCGAGCAGTGCTAACAGAGCA
CTGTTTCCGTATATCACGGATCTACCTGCAACACATACAGAGCCCCAAGACTCGGATACGTTTTTCCAACGATGAGAGAGCTGTCACGTAGTATGCAAGT
GGACGAAGTAGATTGATTTGGGAGAGGTGGCGGGCTAGTATTGCTAGTTTCTTGCACTGCGAGTCAGTCTACCGCAACAAACTATCAAGCTTATTGACGC
TGCCCTTCGCTAGTGGCCGGTGTGGGGCTTGAACGTGCCAAAGCGCCGGAAGGCTTCGTGGGAGTACGCGCCACGGTTTGCCAAGAGGAACATCTCGAGT
TGTGTCTCCGACAGATTGAGCAACTGATAGTACCTCTTGGCATGCTCCAACCGCGAGGCCGACGAACAAGACGAGGGCATCGAAGCCGTCGACGACAAGG
ACGCGCCGTCACGCGGGTACGAGTACAGAGTGCCTGTGAGGCCTTGGCGTAAAGCACCGATATTGAGTAGCATCTGCTGGACGCCTCCGCGTGTGAAGGT
GGAGTCGGTCATCTGTGCGAGGTTGCCGATCAATAGGCGCGACAGCAGCGCATCCGCTCCATTGAAGACAAGCGCCATCTTGTCGCTCGCCAAATACGGC
TGCAGCGCGTTCTCGATCGACGAAAGATTGAGATTGAGCGTGAGCACACTATCCTGAGCCATGGTCGATTGGCCTTCTTCCATGTCAAATCGTTGCGAAA
CGAGCTGCGTGAGGTAGTAGCAGCAGTGCAGGCGCACCTCGCGTCGCAAGAAGAGAAGACATTCATCAGCTAGTGCGCTGCACTGCCAACTCGCAGCTTG
AAGGGCCATTGTGAGTGCTGGTGAGGTGGTTGGTGGGGCTGAATTGTTGTTTGACTTCCCTCCCGAGCCACCCGCGACGCGTTGAAGATACAGCGCAATG
AGATCACACGCGCTGTTGGCGTAACCAAGCATACCGATGCGTGCATTGTCCATAAGGAGACCATTGGGGCCCTGCATCCATGCATCTGGATCATACATCT
CGCGTTCAAGCTCAAGCTCCTGAGCTGCAATCGTCTCTTCCGCGCTTGTCCGAGTAGAATTGGCCCCGCAACTCGCTGATCCTGTCGGTTGCACTTTCGA
ATGATGATACGGAATCGGGCTGCCTTGCTTCGCGCGCTGGTAGCCTTCGTACTCGTGAAAAATGGTTGCCAAGTCAGCATACGTGACGTTTTTGGATTGC
AATTGCTGGTGGTTGAGCGTATGCTCGCGAATATCGCGCACAATCACTGCACATTCTTCCAGCCAGCTCACACCGAGGTTTCCAGCACGCTGGCCAGA