Description :
From Genome Similarity Track
Location :
Scaffold_1506:1689- 2959
Transcript NameFunction/comments
Phyta_totarag13145hypothetical protein PHYSODRAFT_248094
Phyta_totarag13146hypothetical protein

Sequence
1270 bases(100 bases per row)
AGCCGCGCAGTGATCTCGACTCGGATGTGGACTCCGACTACATTGACGCAGGGTTCACCAGTGACAGAAGCAAGGGTCCGATGGACCGGGGTGACTCGGC
TCAGACGCCAGCGAACTCGGCTAGTCGACTGTCCCAGCCATTTGATCTCCAGGATCGAGGGGATCGCCGAGCTCGATTCGATCGCTGAGATGGGTCACGA
GAACGATCACCGTATGGGCCTTGTGCAGCTTGCGGTGGTGCCAACCACTCAGCTCACTTCTGCCGCCGACGTTGCAAGTTCTGCAAGCAAGTCCACGGTG
CAGGGCAATGTGAATTGTTCCCGCGTTACGAGAAGCTTGCCGCGTTCGTCAAGAACACTGTCGACAAGTCCAAGGTGCATGATGACCAACAGGACCTCTA
CGCGCCGAGAGATTTAAACTCGGCGGCCCGCCACCACTGACTGGGTTGGAGACAATCgggccgcagcagccagctGAGTCTGCAGTAGAGGCGAACTTTG
TGTTCGCTTTTGTGGGCAAAGCAGGATGGCCCGAGGGGCAGTGTGGGGATGGCAATTGGATTTATGAAAACGATGGTATTGAACGTGAGCCCGACGAGTC
GAATGAAGACCGACGAGCTATTACAAGTGTAATGGCAACTCAGCGATCGAACAACGCGTCAGACTGCCTCCGGGTGATGAGGCTGCTCCCTGGGGAGCGC
TTAGGGTGGTGGTCATCGCAGAATTTTGATCGCCGAGTTCGAATGAGGGCTCTCGTTATGGGAGCGGTGAATGATCGGCGAACTAAGATGTTGCTGGACA
CCGGGGCAAACGtctcggccagcagcgaAGCCTTCTCTAAGAAGCTGCGATTGAAGCAGCTTACCAGTCGAGATAGACGAATCGACATCCAAGGCATAGG
CAAAGACAATGTGGTGATCACATCGAGGGCTCTAGTCAAAGTGACACTCGGCTGGGAAGTAGCACACGAGTTTGAAGTCTGGATTAAGACCCATCACGCC
GGTGTCGACCTGATTCTTGGCACCGACTTTATGATCCCGGCGGGAATCCGTCTCGACCTATACAACTGGGCGGTTAAGCTTCCCGACGAGGTCGTGGTAC
CTCTCATACGGTCATAAAGTGCATCCGCCGAGCCAGAGTATGAACACCAGATCACGGAGGGACCCACTGAGGCACTCAGCTTATCCAGTAGGTTGATAGC
CGAGTTCAACCTGAGACGACGACAACCTCCTGACTCGACTCATGAGTTCTGGGTGCGTCGAACCAAGGAC